Entry information : EgrPrx63 (Eucgr.B03840 / Egrandis_v1_0.017352m)
Entry ID 8060
Creation 2011-02-04 (Christophe Dunand)
Last sequence changes 2011-02-08 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-10-30 (Qiang Li)
Peroxidase information: EgrPrx63 (Eucgr.B03840 / Egrandis_v1_0.017352m)
Name (synonym) EgrPrx63 (Eucgr.B03840 / Egrandis_v1_0.017352m)
Class Class III peroxidase    [Orthogroup: Prx033]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx63
start..stop
S start..stop
EguPrx63 681 0 1..358 1..358
EcamPrx63 665 0 24..358 23..357
EguPrx62 630 0 1..357 1..360
EgrPrx62 625 0 1..357 1..360
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 62418369..62418599 231 N° 2 62417981..62418160 180 N° 3 62417667..62417826 160 N° 4 62417052..62417557 506
complement(join(62417052..62417557,62417667..62417826,62417981..62418160,6241836 9..62418599))


exon

Literature and cross-references EgrPrx63 (Eucgr.B03840 / Egrandis_v1_0.017352m)
DNA ref. Phytozome 12:   scaffold_2 (62418599..62417052)
Protein sequence: EgrPrx63 (Eucgr.B03840 / Egrandis_v1_0.017352m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   359 (330)
PWM (Da):   %s   37519.3 (34816.9) Transmb domain:   %s   i7-29o
PI (pH):   %s   8.32 (8.20) Peptide Signal:   %s   cut: 29 range:29-358
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTTARAGAALGLALIGLALASLSGSCQGALQVGFYNGKCGFSDVEAIVAGVVAAQIGKDPTIAPALLRMQFHDCFVTGCDASILLDGKSSEKTAPPNLSVRGYDVIDAVKTAVEAVCPGVVSCADIIVMATRDAVSLSGGGRYKVETGRKDGLVSLASNVNLPPPSISVDNSIAAFAQKGLNVSDMVLLLGGHTIGVTHCSLFQDRLYNFQSTGKPDPTMDPSLASALRSTCPNPQTNVDNIVNLDQNPLSASIVDNSFYKQILSHRGILQIDQEIALDGQTKDIVGAIAGGLDFSARFGQAMVKLGALQNGSPGEIRQSCRAINTARKLPTSKDEQRTGKRQQRDNLRARSIPKRGF*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction from phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACGACGGCGCGAGCAGGTGCTGCTTTGGGACTGGCCCTGATTGGCCTCGCGTTGGCGAGCCTGAGCGGGTCTTGCCAAGGCGCGCTTCAGGTTGGGTTCTACAATGGCAAATGTGGG
TTCTCGGATGTCGAGGCCATCGTGGCCGGCGTCGTGGCGGCCCAGATCGGGAAAGACCCTACCATCGCCCCCGCTCTCCTCCGCATGCAGTTTCATGATTGCTTCGTCACT
GTAAGCTAA
TTAGCCTAAATTATTTCATAATAAGCTACTTAAATATTTGATTCGGTTCCCACGCAGGTGCTTTAGAACTAGTCAATTGACTAAAAAAGAAATTATTTAGATGGACAGGATTGTTTAATA
CCAGCACGTTTTGTATGTTAAAATGTTATGATGACTAGATAAATATCATCGGATTTCATTTTGATACGATGAAAATTAGGGTTGCGACGCTTCCATTCTTCTGGATGGAAAGTCGAGCGA
GAAGACGGCACCACCGAATTTGAGCGTCAGAGGCTACGATGTCATTGACGCAGTGAAGACCGCCGTGGAGGCCGTATGCCCCGGAGTCGTTTCCTGTGCCGATATCATTGTAATGGCCAC
AAGGGACGCCGTCTCCCTG
GTAATTAAATCGTACTTTTTGCATAATGCATGATAAGATGTATACACCAAGTGTCTCGATCCGGTTTCATTTTGCTCCTCATATGCTATACTTATATACAC
ATTAGCTCAGTAAATTTCGTGACGTACAAGTGACACATGCTCAAATATTGCAGAGCGGAGGAGGTCGGTACAAGGTAGAAACGGGACGAAAAGACGGGCTCGTATCACTCGCGTCCAATG
TCAATCTCCCACCTCCCTCCATCTCCGTCGACAACTCCATCGCGGCATTCGCTCAAAAGGGACTCAACGTTTCCGACATGGTCCTTCTTCTAG
GTACATATATGCGGCAGTTGAAAAGCC
TAGATCCATGTAAATAAGTATGAAAGTTGTAGCGTGGTATTAGTGTTTGTTCCTGAAAAAACTGCTATCGGTGGTGTCCTAGGTGGCCACACGATCGGCGTTACTCACTGCTCGCTCTTC
CAAGACCGCCTGTACAATTTCCAGAGTACCGGGAAACCCGACCCAACCATGGACCCTTCATTGGCTTCCGCCCTAAGGTCGACGTGCCCTAACCCTCAGACTAATGTCGACAACATTGTC
AATCTCGACCAGAACCCTTTGAGTGCTTCGATCGTCGACAACTCCTTCTACAAGCAGATACTCTCCCATAGAGGGATACTGCAGATCGATCAGGAGATCGCACTGGACGGGCAGACCAAA
GACATTGTGGGAGCGATTGCGGGTGGGCTCGACTTCTCGGCTAGGTTCGGCCAAGCCATGGTCAAGTTGGGCGCACTCCAGAATGGCTCCCCGGGGGAGATAAGGCAATCCTGCAGAGCT
ATCAACACGGCTCGTAAGCTGCCTACTTCCAAAGATGAGCAGAGGACAGGCAAGAGGCAGCAGAGAGACAACCTGAGAGCCCGTTCAATTCCAAAGCGTGGATTTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACGACGGCGCGAGCAGGTGCTGCTTTGGGACTGGCCCTGATTGGCCTCGCGTTGGCGAGCCTGAGCGGGTCTTGCCAAGGCGCGCTTCAGGTTGGGTTCTACAATGGCAAATGTGGG
TTCTCGGATGTCGAGGCCATCGTGGCCGGCGTCGTGGCGGCCCAGATCGGGAAAGACCCTACCATCGCCCCCGCTCTCCTCCGCATGCAGTTTCATGATTGCTTCGTCACT
GGTTGCGAC
GCTTCCATTCTTCTGGATGGAAAGTCGAGCGAGAAGACGGCACCACCGAATTTGAGCGTCAGAGGCTACGATGTCATTGACGCAGTGAAGACCGCCGTGGAGGCCGTATGCCCCGGAGTC
GTTTCCTGTGCCGATATCATTGTAATGGCCACAAGGGACGCCGTCTCCCTG
AGCGGAGGAGGTCGGTACAAGGTAGAAACGGGACGAAAAGACGGGCTCGTATCACTCGCGTCCAATGTC
AATCTCCCACCTCCCTCCATCTCCGTCGACAACTCCATCGCGGCATTCGCTCAAAAGGGACTCAACGTTTCCGACATGGTCCTTCTTCTAG
GTGGCCACACGATCGGCGTTACTCACTGC
TCGCTCTTCCAAGACCGCCTGTACAATTTCCAGAGTACCGGGAAACCCGACCCAACCATGGACCCTTCATTGGCTTCCGCCCTAAGGTCGACGTGCCCTAACCCTCAGACTAATGTCGAC
AACATTGTCAATCTCGACCAGAACCCTTTGAGTGCTTCGATCGTCGACAACTCCTTCTACAAGCAGATACTCTCCCATAGAGGGATACTGCAGATCGATCAGGAGATCGCACTGGACGGG
CAGACCAAAGACATTGTGGGAGCGATTGCGGGTGGGCTCGACTTCTCGGCTAGGTTCGGCCAAGCCATGGTCAAGTTGGGCGCACTCCAGAATGGCTCCCCGGGGGAGATAAGGCAATCC
TGCAGAGCTATCAACACGGCTCGTAAGCTGCCTACTTCCAAAGATGAGCAGAGGACAGGCAAGAGGCAGCAGAGAGACAACCTGAGAGCCCGTTCAATTCCAAAGCGTGGATTTTAG

Retrieve as FASTA