Entry information : EgrPrx62 (Eucgr.B03838 / Egrandis_v1_0.043210m)
Entry ID 8064
Creation 2011-02-04 (Christophe Dunand)
Last sequence changes 2011-03-25 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-10-30 (Qiang Li)
Peroxidase information: EgrPrx62 (Eucgr.B03838 / Egrandis_v1_0.043210m)
Name (synonym) EgrPrx62 (Eucgr.B03838 / Egrandis_v1_0.043210m)
Class Class III peroxidase    [Orthogroup: Prx033]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx62
start..stop
S start..stop
EglPrx62 735 0 1..363 1..363
EguPrx62 726 0 1..363 1..363
EcamPrx62 658 0 1..331 1..331
EguPrx63 598 0 1..360 1..357
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 62411272..62411502 231 N° 2 62410917..62411096 180 N° 3 62410599..62410758 160 N° 4 62409953..62410473 521
complement(join(62409953..62410473,62410599..62410758,62410917..62411096,6241127 2..62411502))


exon

Literature and cross-references EgrPrx62 (Eucgr.B03838 / Egrandis_v1_0.043210m)
DNA ref. Phytozome 12:   scaffold_2 (62411502..62409953)
Protein sequence: EgrPrx62 (Eucgr.B03838 / Egrandis_v1_0.043210m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   364 (335)
PWM (Da):   %s   38443.83 (35724.4) Transmb domain:   %s   i7-29o
PI (pH):   %s   8.96 (8.91) Peptide Signal:   %s   cut: 29 range:29-363
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATLRAGAALGLALIGLVLASLSGSCHGALQVGFYNGKCRVSDVEAIVAGVVAARFSKDPTVAPALLRMQFHDCFVTGCDASILLDGKSSEKTALPNLSVKGYDVIDSAKAAVETICPGVVSCADIIVMATRDAVSLSGGGRYRVETGRKDGLVSLASNVNLPPPSISVNDSIAAFAQKGLTVSDMVLLLGGHTIGIAHCSLFQDRLYNYQNTGKPDPTMDPSLASALRSTCPNKQTNVDNIVNLDQDPLSSSIVDNSFYKQILARRGILQIDQEIALDRQTKDIVGAIAGRLDFSTRFGEAMVKLGTLQNGAPGEIRQSCRAINTARKLPTSKDKQRMGRTGWTRWSGDPRALSIQKRGSSD*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction from phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGACGCTGCGAGCAGGTGCTGCTTTGGGACTGGCCCTGATCGGCCTCGTGTTGGCGAGCCTGAGCGGGTCTTGCCACGGTGCTCTTCAGGTCGGGTTCTACAATGGCAAATGTAGG
GTCTCGGATGTCGAGGCCATCGTGGCCGGCGTCGTGGCGGCCAGGTTCAGCAAGGACCCCACCGTCGCCCCCGCTCTCCTCCGCATGCAGTTTCATGATTGCTTCGTCACT
GTAAGCTAA
TTAGCCTAAATTACTTCATGTAAAGCTACTTAAATGTTCAATTTGGTTCCCCCGCACGTGCTTTAGAACTAGTCTATTGACTAATAAAGAAATTATGTAGATGGATGGGATTGTGTAAGA
CCGGCTCGTTTTGTATGTTAAAATGTTACAATGACTAAATAATTAGGGCTGCGACGCCTCCATTCTTCTGGACGGAAAATCGAGCGAGAAGACTGCGCTGCCAAATTTGAGTGTCAAGGG
CTACGATGTCATTGACTCCGCAAAGGCTGCCGTGGAGACCATATGCCCCGGGGTTGTTTCCTGCGCCGATATCATTGTCATGGCAACTAGAGATGCCGTGTCCCTG
GTAATTAAATCGTA
TTTTCCGCATAACTCATGATAAGATGCATGCGCTAAGCGTCTCGATCCAGTGACATTCTGCTCTTCTCATATGCTATACTTATATACACATTGGCTTAGTAAATTTCATGACGTACGCGT
GAGACACATGCTCAAATATTGCAGAGCGGAGGAGGTCGGTACAGGGTAGAAACGGGACGGAAAGACGGGCTCGTATCGCTCGCGTCCAACGTCAATCTCCCCCCTCCCTCCATCTCCGTC
AATGACTCCATCGCGGCATTCGCTCAAAAAGGACTCACCGTTTCCGACATGGTCCTTCTTCTAG
GTACGTCTATGCAGCATCGTCGTCCCCAATCAATTGAAAACCCCAGATCCATGCAA
ATAAGTTCGAAAGTTGTAGTCTGGTATGGTGTTTGTTCTTATAAAAAACTGCTACTGGTCGTGTCCTAGGTGGCCACACGATCGGCATTGCTCACTGCTCGCTCTTCCAAGACCGGCTTT
ACAATTACCAGAATACCGGGAAACCTGACCCGACCATGGACCCTTCCTTGGCTTCCGCCCTAAGGTCGACGTGCCCTAACAAGCAGACTAACGTCGACAACATTGTCAATCTCGACCAGG
ATCCTCTGAGCTCATCGATCGTCGACAACTCCTTCTACAAGCAGATACTCGCCCGTAGAGGGATTCTGCAGATCGATCAGGAGATCGCGCTGGACAGGCAGACCAAGGACATTGTGGGAG
CGATCGCCGGCAGACTTGACTTCTCGACTAGGTTTGGCGAAGCCATGGTTAAGTTGGGCACACTCCAGAATGGCGCTCCTGGGGAGATAAGGCAATCCTGCAGAGCTATCAATACGGCTC
GTAAGCTGCCTACTTCCAAAGATAAGCAGAGGATGGGCCGGACAGGGTGGACGCGGTGGAGCGGTGACCCGAGAGCCCTTTCGATTCAGAAGCGTGGCTCTTCAGACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGACGCTGCGAGCAGGTGCTGCTTTGGGACTGGCCCTGATCGGCCTCGTGTTGGCGAGCCTGAGCGGGTCTTGCCACGGTGCTCTTCAGGTCGGGTTCTACAATGGCAAATGTAGG
GTCTCGGATGTCGAGGCCATCGTGGCCGGCGTCGTGGCGGCCAGGTTCAGCAAGGACCCCACCGTCGCCCCCGCTCTCCTCCGCATGCAGTTTCATGATTGCTTCGTCACT
GGCTGCGAC
GCCTCCATTCTTCTGGACGGAAAATCGAGCGAGAAGACTGCGCTGCCAAATTTGAGTGTCAAGGGCTACGATGTCATTGACTCCGCAAAGGCTGCCGTGGAGACCATATGCCCCGGGGTT
GTTTCCTGCGCCGATATCATTGTCATGGCAACTAGAGATGCCGTGTCCCTG
AGCGGAGGAGGTCGGTACAGGGTAGAAACGGGACGGAAAGACGGGCTCGTATCGCTCGCGTCCAACGTC
AATCTCCCCCCTCCCTCCATCTCCGTCAATGACTCCATCGCGGCATTCGCTCAAAAAGGACTCACCGTTTCCGACATGGTCCTTCTTCTAG
GTGGCCACACGATCGGCATTGCTCACTGC
TCGCTCTTCCAAGACCGGCTTTACAATTACCAGAATACCGGGAAACCTGACCCGACCATGGACCCTTCCTTGGCTTCCGCCCTAAGGTCGACGTGCCCTAACAAGCAGACTAACGTCGAC
AACATTGTCAATCTCGACCAGGATCCTCTGAGCTCATCGATCGTCGACAACTCCTTCTACAAGCAGATACTCGCCCGTAGAGGGATTCTGCAGATCGATCAGGAGATCGCGCTGGACAGG
CAGACCAAGGACATTGTGGGAGCGATCGCCGGCAGACTTGACTTCTCGACTAGGTTTGGCGAAGCCATGGTTAAGTTGGGCACACTCCAGAATGGCGCTCCTGGGGAGATAAGGCAATCC
TGCAGAGCTATCAATACGGCTCGTAAGCTGCCTACTTCCAAAGATAAGCAGAGGATGGGCCGGACAGGGTGGACGCGGTGGAGCGGTGACCCGAGAGCCCTTTCGATTCAGAAGCGTGGC
TCTTCAGACTGA

Retrieve as FASTA