Entry information : EgrPrx86 (Eucgr.E04056 / Egrandis_v1_0.018665m)
Entry ID 8076
Creation 2011-02-04 (Christophe Dunand)
Last sequence changes 2011-02-04 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-10-30 (Qiang Li)
Peroxidase information: EgrPrx86 (Eucgr.E04056 / Egrandis_v1_0.018665m)
Name (synonym) EgrPrx86 (Eucgr.E04056 / Egrandis_v1_0.018665m)
Class Class III peroxidase    [Orthogroup: Prx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx86
start..stop
S start..stop
EglPrx86 702 0 1..337 1..337
EguPrx86 687 0 1..337 1..337
EcamPrx86 643 0 27..337 3..313
PtrePrx01 600 0 1..337 1..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 69654789..69655037 249 N° 2 69655225..69655413 189 N° 3 69656017..69656182 166 N° 4 69656332..69656741 410
join(69654789..69655037,69655225..69655413,69656017..69656182,69656332..69656741 )


exon

Literature and cross-references EgrPrx86 (Eucgr.E04056 / Egrandis_v1_0.018665m)
DNA ref. Phytozome 12:   scaffold_5 (69654789..69656741)
Protein sequence: EgrPrx86 (Eucgr.E04056 / Egrandis_v1_0.018665m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   338 (311)
PWM (Da):   %s   38165.4 (35057.9) Transmb domain:   %s   i7-26o
PI (pH):   %s   7.78 (7.50) Peptide Signal:   %s   cut: 27 range:27-337
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGFRALFFFAAIFFSFSTTIIYSAYAEGEAEAEVGSGLVIDFYKDTCPQAEDIIKEQVKLLYKRHKNTAFSWLRNIFHDCAVQSCDASLLLDSTRRDLSEKETDRSFGMRNFRYLDTIKEAVERECPGVVSCADILVLSARDGVVALGGPQIPLKTGRRDGRRSRADVIEEHLPDHNESMSVVLERFAKMGIDTPGVVALLGAHSVGRTHCVKLVQRLYPEVDPALNPDHVEHMLYKCPDPIPDPKAVQYVRNDRGTPMIFDNNYYRNILDNKGLLLVDHQLAVDKRTKPYVKKMAKSQNYFFKEFARALTTLSENNPLTGDKGEIRRQCNVANKHH*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction from phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTTCAGAGCTCTCTTCTTCTTTGCTGCCATCTTCTTCTCCTTCTCAACCACAATCATCTACTCTGCTTATGCAGAGGGTGAGGCTGAGGCTGAGGTAGGGTCTGGCCTGGTGATA
GACTTCTACAAGGACACTTGTCCTCAGGCTGAGGACATCATTAAAGAGCAAGTCAAGCTTCTCTACAAGCGCCACAAGAACACTGCATTCTCTTGGCTTAGGAACATCTTCCATGACTGT
GCTGTTCAA
GTGAGCTAGCTTTCCTTCCATTTGCTTATCTGTCTTTTCTTTTCGTTTTTCTTTCCAAGAATTTAAGTTAAAGGTGTTGCAGTCTTGTTCATCTTTCTTTGCCTTTTTCTT
TTTACCCAAAGAAATGCTGCCTTCTGAAGCTAAAGTTTTGATCTTTTCACTGTTTGGGCATGTGGGTGTTGCACAGTCTTGCGATGCTTCATTGCTCCTGGACTCAACAAGGAGGGATCT
CTCTGAGAAAGAGACGGACAGGAGCTTTGGGATGAGGAACTTCAGGTACCTTGACACCATCAAGGAGGCTGTGGAGAGAGAATGTCCTGGAGTTGTTTCTTGTGCAGACATTCTGGTGTT
GTCTGCTAGAGATGGCGTTGTTGCG
GTACTTATGAATCTTTCACCCTCCAGATTATCAATTTTCCTCTCTGCATGCGGTGCTCGTGTCATTTCCTAGATTGTATCTGTTTCACAGATGCG
ACTTATAAAAAGATTTTCAAATGGGTCTAGTTCATGACATTCTATGATCTTTTGCTGACTCTGTAAAAAAGAAAGAAAGACAATAGTAGATATTTCAAGAATACTTTTCTGGGAAGAAAA
TCTAGTTGTGATTGATCCCTTCCAGTTCCTACTTGGGGGAGGTATCATGCGAGCACTACCATGGATATGGCAAAAATTCCATTTTTGACCTTGATCTCAGTGCCCTTTTCTTGAATTAAA
TGCTCTTTTGACTCATAACTGCAACAACTATTTCATTTCTGGCCAAACAAGAAAACTATTACAGGATTTCCAGTTTCAGCTTTAGGGAGAATTTGATTATAAGAATAAAAAAGGACAGCT
GCATGAACTTCAGATCTTACTGATGAGGGTTTTACTGTTTAGAAAAAAATGGGAGGAAAAAGAAAATCAATGGGCTTTATTAAATCTAAGCAGATCTGGCATAAATCTGTTCTCTAAACT
TTAAAAGCTATATTCTTTTCCTCACCAGCTAGGAGGCCCTCAAATTCCTCTGAAAACTGGAAGAAGAGATGGCAGGAGGAGCAGAGCAGATGTCATTGAGGAACACTTGCCAGACCACAA
CGAGAGCATGTCTGTTGTGCTTGAAAGATTTGCAAAGATGGGCATTGATACTCCTGGAGTGGTTGCCTTGCTCG
GTACTTTCATTTGGTGCTTCTTGAATTAATTCTAAGCTTCTGACTA
GTGTCTGAATTAAAGCGTTCATACTCAATCCAAATCCATTCTCACTAGAGTCCGTTGCCTGCAATTGATGGAGTCTAACAATGTCTTATATTGCATCTAACAGGAGCACACAGCGTGGGC
CGAACCCACTGCGTCAAGCTGGTTCAGCGGCTATACCCAGAGGTTGACCCAGCCCTCAATCCCGACCATGTGGAGCACATGCTCTACAAGTGCCCGGACCCGATCCCTGACCCAAAGGCC
GTGCAGTACGTGAGGAACGACCGTGGCACCCCCATGATATTCGACAACAACTATTACAGGAACATATTGGACAACAAGGGCTTGCTCCTGGTGGATCACCAGCTAGCCGTTGATAAGAGG
ACCAAGCCCTATGTGAAGAAGATGGCCAAGAGCCAAAACTACTTCTTCAAGGAATTCGCCAGAGCCCTCACCACCCTTTCTGAGAACAACCCGCTTACCGGAGACAAGGGTGAGATCAGG
AGGCAATGCAACGTTGCCAACAAACACCACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTTCAGAGCTCTCTTCTTCTTTGCTGCCATCTTCTTCTCCTTCTCAACCACAATCATCTACTCTGCTTATGCAGAGGGTGAGGCTGAGGCTGAGGTAGGGTCTGGCCTGGTGATA
GACTTCTACAAGGACACTTGTCCTCAGGCTGAGGACATCATTAAAGAGCAAGTCAAGCTTCTCTACAAGCGCCACAAGAACACTGCATTCTCTTGGCTTAGGAACATCTTCCATGACTGT
GCTGTTCAA
TCTTGCGATGCTTCATTGCTCCTGGACTCAACAAGGAGGGATCTCTCTGAGAAAGAGACGGACAGGAGCTTTGGGATGAGGAACTTCAGGTACCTTGACACCATCAAGGAG
GCTGTGGAGAGAGAATGTCCTGGAGTTGTTTCTTGTGCAGACATTCTGGTGTTGTCTGCTAGAGATGGCGTTGTTGCG
CTAGGAGGCCCTCAAATTCCTCTGAAAACTGGAAGAAGAGAT
GGCAGGAGGAGCAGAGCAGATGTCATTGAGGAACACTTGCCAGACCACAACGAGAGCATGTCTGTTGTGCTTGAAAGATTTGCAAAGATGGGCATTGATACTCCTGGAGTGGTTGCCTTG
CTCG
GAGCACACAGCGTGGGCCGAACCCACTGCGTCAAGCTGGTTCAGCGGCTATACCCAGAGGTTGACCCAGCCCTCAATCCCGACCATGTGGAGCACATGCTCTACAAGTGCCCGGAC
CCGATCCCTGACCCAAAGGCCGTGCAGTACGTGAGGAACGACCGTGGCACCCCCATGATATTCGACAACAACTATTACAGGAACATATTGGACAACAAGGGCTTGCTCCTGGTGGATCAC
CAGCTAGCCGTTGATAAGAGGACCAAGCCCTATGTGAAGAAGATGGCCAAGAGCCAAAACTACTTCTTCAAGGAATTCGCCAGAGCCCTCACCACCCTTTCTGAGAACAACCCGCTTACC
GGAGACAAGGGTGAGATCAGGAGGCAATGCAACGTTGCCAACAAACACCACTAG

Retrieve as FASTA