Entry information : EgrPrx85 (Eucgr.E03999 / Egrandis_v1_0.044863m)
Entry ID 8077
Creation 2011-02-04 (Christophe Dunand)
Last sequence changes 2011-02-25 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-10-30 (Qiang Li)
Peroxidase information: EgrPrx85 (Eucgr.E03999 / Egrandis_v1_0.044863m)
Name (synonym) EgrPrx85 (Eucgr.E03999 / Egrandis_v1_0.044863m)
Class Class III peroxidase    [Orthogroup: Prx039]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx85
start..stop
S start..stop
EglPrx85 654 0 1..319 1..319
EcamPrx85 650 0 1..319 1..319
EguPrx85 643 0 1..319 1..319
GmPrx324 432 1e-153 20..319 24..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 68955114..68955323 210 N° 2 68954309..68954660 352 N° 3 68953515..68953912 398  
complement(join(68953515..68953912,68954309..68954660,68955114..68955323))


exon

Literature and cross-references EgrPrx85 (Eucgr.E03999 / Egrandis_v1_0.044863m)
DNA ref. Phytozome 12:   scaffold_5 (68955323..68953515)
Protein sequence: EgrPrx85 (Eucgr.E03999 / Egrandis_v1_0.044863m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   319 (296)
PWM (Da):   %s   34850.67 (32519.5)  
PI (pH):   %s   6.76 (6.77) Peptide Signal:   %s   cut: 24 range:24-319
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGRAQCIGMAALLMAVWIGVSDGQLAYDYYKTTCPNAEDIVRREMLSFAFLDATAPAAFLRLMFHDCQVQGCDASILLDAIGSKSEIKSSRNFGIRKLDAIEYVKSALEAECPGQVSCADIIALAARESVALSGGPHIAIPLGRKDSRASNYQQADAHLPSPSISVDAFLHIFMTKGLNLEESVAILGAHTLGAGHCLNIIDRLYNPKPDDLMNPVFEARLRLQCPTLNPLMNLTATSNDITPTIFDNQYYRDILLGKGLFFIDSSISRDPRTSDIVKQFAIDQDYFFRAFSSAFVKLSSANTLSKTKGEVRKQCSRVN

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction from phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGAGGGCTCAGTGCATAGGAATGGCAGCATTATTGATGGCTGTGTGGATTGGGGTGAGTGATGGTCAGCTGGCTTATGATTACTACAAGACAACATGTCCAAATGCTGAGGACATT
GTCAGGAGGGAGATGCTGAGCTTTGCTTTCTTGGATGCAACTGCACCCGCTGCCTTTCTCAGGCTCATGTTTCACGACTGCCAAGTTCAG
GTAATCATCACTTCATACACACAACCGTTC
CATCATTTCCTCAATCATTCCTCAATCATGCATGGTGTCATGTTGTGTCTGTGTATCCTCTGAAGAGAGAGAGAGAGAGAGACGTACATAAATGCATGAAAGTTAGACTGCACTCCCTAC
CTACATTGATCTCAGAACATACAAAGAGATTTTCTTACCATAACTAACATATTCCACAGTTCTAGCATTCGGCTTCTCAATTGAATACATCCCTTTTTTACAACTCCCATTTCCTGGAAT
GTTAAACATTATTGTAGAACACCTTTGAAAACATGTTTTTCGAGTTGGTGTTGCACTGAGAGTTCTTTTTTTCTCTCTCTAGGGAGATACTGAGAGTGCATTATCCTTTGTTTAGTTGAT
AATATCTCGAGCTTGTTGCTTTCTTCCATAACTACATGATAACTATACTTCTCATTTTTTTAGGGATGCGATGCTTCGATACTTCTCGACGCGATTGGCTCGAAGTCGGAGATAAAATCG
TCCAGGAACTTCGGCATCAGGAAACTCGATGCGATCGAGTATGTTAAGTCGGCATTGGAAGCCGAATGCCCGGGCCAGGTATCTTGTGCAGACATAATTGCACTAGCTGCAAGAGAATCG
GTGGCTCTGAGTGGAGGACCACACATTGCCATTCCTCTTGGAAGGAAAGACTCGAGAGCTAGTAATTACCAGCAAGCCGATGCTCATCTCCCTTCTCCAAGTATTTCTGTCGATGCATTC
CTTCATATCTTCATGACTAAAGGGTTGAATCTCGAGGAATCAGTCGCGATCTTGG
GTAAGAATCATGTATCATTAATCTCGATATTGATCAACTAAACACATCGGCAGAACTTGTCCTAA
TCAGTGGCATTAATGAATCTATATGTGAATAAACTAAGCCTGATAGACTCTTCAAAAGGAGATTCTGCCGATCACGGCTAGTCCAGTATCAGAGTACGGTTTTTGCATTAGCTAATGTGA
TACCAACGTACCTGTTTTGCGACATACTTGTTCATAGAAGTAGAACTCGATAGCGATTGTATGTAGATAATATTTTGCACATTGAAGATCGACCGATCATTTTTGTTTTGTAACATGAAT
TTGAGCTGCTATAACCATTTAGAATGAATCAAGACTAGTGCTGATCCGTACTAACAAGTACGGACACTGCCGTGTGAACCGCTCTTTGCAGGTGCACATACACTAGGCGCCGGACACTGC
CTGAACATCATCGACAGATTGTACAACCCGAAACCCGACGATCTAATGAACCCAGTGTTCGAAGCTCGGCTCAGACTACAATGCCCAACTCTAAATCCCCTAATGAATCTCACAGCCACA
TCCAACGACATAACCCCAACAATATTCGATAACCAGTACTACAGGGACATATTGTTGGGCAAGGGCTTGTTTTTCATCGACTCAAGCATCTCAAGAGATCCTCGCACTTCTGACATCGTC
AAGCAATTCGCCATTGATCAGGACTACTTCTTTCGCGCATTCTCTTCAGCATTCGTCAAGCTCTCTTCAGCCAACACCCTCAGCAAGACGAAGGGCGAAGTGCGGAAGCAATGCAGCAGG
GTGAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGAGGGCTCAGTGCATAGGAATGGCAGCATTATTGATGGCTGTGTGGATTGGGGTGAGTGATGGTCAGCTGGCTTATGATTACTACAAGACAACATGTCCAAATGCTGAGGACATT
GTCAGGAGGGAGATGCTGAGCTTTGCTTTCTTGGATGCAACTGCACCCGCTGCCTTTCTCAGGCTCATGTTTCACGACTGCCAAGTTCAG
GGATGCGATGCTTCGATACTTCTCGACGCG
ATTGGCTCGAAGTCGGAGATAAAATCGTCCAGGAACTTCGGCATCAGGAAACTCGATGCGATCGAGTATGTTAAGTCGGCATTGGAAGCCGAATGCCCGGGCCAGGTATCTTGTGCAGAC
ATAATTGCACTAGCTGCAAGAGAATCGGTGGCTCTGAGTGGAGGACCACACATTGCCATTCCTCTTGGAAGGAAAGACTCGAGAGCTAGTAATTACCAGCAAGCCGATGCTCATCTCCCT
TCTCCAAGTATTTCTGTCGATGCATTCCTTCATATCTTCATGACTAAAGGGTTGAATCTCGAGGAATCAGTCGCGATCTTGG
GTGCACATACACTAGGCGCCGGACACTGCCTGAACATC
ATCGACAGATTGTACAACCCGAAACCCGACGATCTAATGAACCCAGTGTTCGAAGCTCGGCTCAGACTACAATGCCCAACTCTAAATCCCCTAATGAATCTCACAGCCACATCCAACGAC
ATAACCCCAACAATATTCGATAACCAGTACTACAGGGACATATTGTTGGGCAAGGGCTTGTTTTTCATCGACTCAAGCATCTCAAGAGATCCTCGCACTTCTGACATCGTCAAGCAATTC
GCCATTGATCAGGACTACTTCTTTCGCGCATTCTCTTCAGCATTCGTCAAGCTCTCTTCAGCCAACACCCTCAGCAAGACGAAGGGCGAAGTGCGGAAGCAATGCAGCAGGGTGAACTAA

Retrieve as FASTA