Entry information : SbPrx06 (Sobic.001G235800.1[2.1] / SB01G020830[1.4])
Entry ID 808
Creation 2005-12-28 (Christophe Dunand)
Last sequence changes 2005-12-28 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-01 (Messaoudi)
Peroxidase information: SbPrx06 (Sobic.001G235800.1[2.1] / SB01G020830[1.4])
Name (synonym) SbPrx06 (Sobic.001G235800.1[2.1] / SB01G020830[1.4])
Class Class III peroxidase    [Orthogroup: Prx023]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue types Leaves
Roots
Inducers Acid treatment
Alkaline treatment
Oxidative stress
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx06
start..stop
S start..stop
ZmPrx86 560 0 4..326 5..331
SiPrx159 557 0 1..326 1..326
ZmPrx11 553 0 1..326 1..328
OsPrx126 515 0 1..326 1..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 23829880..23830098 219 N° 2 23830223..23830405 183 N° 3 23830495..23830660 166 N° 4 23830788..23831200 413
join(23829880..23830098,23830223..23830405,23830495..23830660,23830788..23831200 )


exon

Literature and cross-references SbPrx06 (Sobic.001G235800.1[2.1] / SB01G020830[1.4])
Literature Cordonnier-Pratt,M.-M. et al., unpublished
DNA ref. Phytozome 12:   chromosome_1 (23829880..23831200)
Protein sequence: SbPrx06 (Sobic.001G235800.1[2.1] / SB01G020830[1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (300)
PWM (Da):   %s   35363.26 (32492.9)  
PI (pH):   %s   4.64 (4.48) Peptide Signal:   %s   cut: 27 range:27-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MENSYCRWVLVCSVLALCLGSRGARCELTPNFYHSTCPQLYYIVRHHVFVAMRAEMRMGASLLRLHFHDCFVNGCDGSILLDGSDGEKFARPNLNSVRGYEVIDAIKADLERVCPEVVSCADIVALAASYGVLFSGGPYYNVLLGRKDGLVANQSGADNGLPSPFEPIDLIIQKFDDVGLNTTDVVVLSGAHTIGRARCALFSNRLSNFSTTESVDPTLEASLADSLESLCAGGDGNQTSALDVTSPYVFDNNYYKNLLTEKGLLSSDQGLFSSPEGVANTKDLVETYSSNSEQFFCDFVWSMIKMGNIPLTANDGEIRKNCRVAN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, 3 introns) and 22 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGAACTCTTACTGCCGTTGGGTGCTTGTATGTTCGGTTCTTGCGCTGTGCCTCGGTAGCCGGGGTGCGAGGTGTGAGCTAACACCAAATTTCTACCACAGCACTTGCCCTCAGCTG
TACTATATTGTGCGGCATCATGTGTTCGTTGCCATGAGAGCTGAGATGAGGATGGGTGCCTCCCTCCTCAGGCTACATTTCCATGACTGCTTTGTCAAT
GTAACTGTCACACTCGATCGG
CTGAATTCTACATCCCTCAAGACTGAATTATTATTTCTAGTAATCTTCTTCTCCATAAATTCATGATGATGAAGTTACTGAAATGGTGTATGCATGCATGCAGGGGTGTGACGGTTCGAT
CCTTTTGGATGGCTCCGATGGCGAGAAGTTTGCAAGACCCAACCTGAACTCAGTCAGAGGGTACGAGGTCATTGACGCGATAAAGGCTGATCTCGAGCGCGTCTGCCCCGAGGTGGTGTC
ATGCGCTGACATTGTAGCCCTTGCAGCCAGCTATGGAGTACTCTTT
GTAAGCTCCTCCTTCTACCCCTTACTCTGTCGGAACATTCAGTTGTTTCAGACAAAAGGCTAACACTGCGTGCG
ACGGCTGTTGTTCAGAGTGGAGGGCCTTACTACAATGTTCTTCTGGGGAGAAAGGACGGGCTGGTGGCCAATCAGTCTGGAGCTGACAACGGTTTGCCTTCGCCGTTCGAACCCATTGAT
TTGATTATTCAGAAGTTCGACGATGTGGGCCTGAACACGACCGACGTCGTGGTCTTATCAG
GTGAAAGTCTCGCCGAGTTGCCCAGAAATGCATCTTTTTTGTGGGGGAGACAGAGATGA
AGCTCCTTCATTGTGATGTGATTCTGCACAACTCACATGATCTGAATCTGAAACTTGAAAATGAACAGGAGCCCACACTATCGGGCGAGCCCGGTGCGCGCTGTTCAGCAACCGGCTGTC
CAACTTCTCGACCACGGAGTCAGTTGACCCGACGCTGGAGGCCAGCCTCGCCGACAGCCTCGAGAGCCTCTGCGCAGGCGGCGACGGCAACCAGACCTCTGCGCTCGACGTCACGTCCCC
CTACGTGTTCGACAACAACTACTACAAGAACCTCCTGACGGAGAAGGGCCTCCTGTCCTCCGATCAGGGTCTCTTCTCCAGCCCTGAAGGCGTCGCCAACACAAAGGATTTGGTGGAGAC
CTACAGCAGTAATAGCGAACAGTTCTTCTGTGACTTCGTCTGGTCCATGATCAAGATGGGGAACATCCCGCTCACGGCCAACGACGGGGAGATCCGCAAGAACTGCAGAGTAGCGAACTA
A

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGAACTCTTACTGCCGTTGGGTGCTTGTATGTTCGGTTCTTGCGCTGTGCCTCGGTAGCCGGGGTGCGAGGTGTGAGCTAACACCAAATTTCTACCACAGCACTTGCCCTCAGCTG
TACTATATTGTGCGGCATCATGTGTTCGTTGCCATGAGAGCTGAGATGAGGATGGGTGCCTCCCTCCTCAGGCTACATTTCCATGACTGCTTTGTCAAT
GGGTGTGACGGTTCGATCCTT
TTGGATGGCTCCGATGGCGAGAAGTTTGCAAGACCCAACCTGAACTCAGTCAGAGGGTACGAGGTCATTGACGCGATAAAGGCTGATCTCGAGCGCGTCTGCCCCGAGGTGGTGTCATGC
GCTGACATTGTAGCCCTTGCAGCCAGCTATGGAGTACTCTTT
AGTGGAGGGCCTTACTACAATGTTCTTCTGGGGAGAAAGGACGGGCTGGTGGCCAATCAGTCTGGAGCTGACAACGGT
TTGCCTTCGCCGTTCGAACCCATTGATTTGATTATTCAGAAGTTCGACGATGTGGGCCTGAACACGACCGACGTCGTGGTCTTATCAG
GAGCCCACACTATCGGGCGAGCCCGGTGCGCG
CTGTTCAGCAACCGGCTGTCCAACTTCTCGACCACGGAGTCAGTTGACCCGACGCTGGAGGCCAGCCTCGCCGACAGCCTCGAGAGCCTCTGCGCAGGCGGCGACGGCAACCAGACCTCT
GCGCTCGACGTCACGTCCCCCTACGTGTTCGACAACAACTACTACAAGAACCTCCTGACGGAGAAGGGCCTCCTGTCCTCCGATCAGGGTCTCTTCTCCAGCCCTGAAGGCGTCGCCAAC
ACAAAGGATTTGGTGGAGACCTACAGCAGTAATAGCGAACAGTTCTTCTGTGACTTCGTCTGGTCCATGATCAAGATGGGGAACATCCCGCTCACGGCCAACGACGGGGAGATCCGCAAG
AACTGCAGAGTAGCGAACTAA

Retrieve as FASTA