Entry information : EgrPrx68 (Eucgr.C02389 / Egrandis_v1_0.019381m)
Entry ID 8082
Creation 2011-02-04 (Christophe Dunand)
Last sequence changes 2011-02-04 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-10-30 (Qiang Li)
Peroxidase information: EgrPrx68 (Eucgr.C02389 / Egrandis_v1_0.019381m)
Name (synonym) EgrPrx68 (Eucgr.C02389 / Egrandis_v1_0.019381m)
Class Class III peroxidase    [Orthogroup: Prx020]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx68
start..stop
S start..stop
EglPrx68 671 0 1..325 1..325
EguPrx68 662 0 1..325 1..325
EgrPrx67 654 0 1..325 1..325
EcamPrx67 647 0 1..325 1..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 44358899..44359105 207 N° 2 44358599..44358796 198 N° 3 44357848..44358013 166 N° 4 44356816..44357222 407
complement(join(44356816..44357222,44357848..44358013,44358599..44358796,4435889 9..44359105))


exon

Literature and cross-references EgrPrx68 (Eucgr.C02389 / Egrandis_v1_0.019381m)
DNA ref. Phytozome 12:   scaffold_3 (44359105..44356816)
Protein sequence: EgrPrx68 (Eucgr.C02389 / Egrandis_v1_0.019381m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (303)
PWM (Da):   %s   35548.06 (33068.8)  
PI (pH):   %s   9.32 (9.29) Peptide Signal:   %s   cut: 23 range:23-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEARRFLVSCLSFALLLSAVSAQLRTDFYKNTCPNVESLVRSAVTKKFQQTFVTAPATLRLLFHDCFVRGCDASVLIASPTNNAEKDHPDDLSLAGDGFDTVIKAKAAVDSVPQCKNKVSCADILALATRDVVSLAGGPFYSVELGRRDGRISTKLGVQHNLPQPGSKLDQLNSMFSSHGLSQTDMIALSGAHTIGFSHCGKFSKRIYNFSPRSSIDPTLNFRYALQLRQMCPINVDPRIAINMDPTTPQTFDNAYYKNLQQGKGLFVSDQTLFSDPRSRATVNLFASNNAAFQQAFVTAITKMGRIGVKTGNQGEIRIDCTRPN*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction from phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGGCTCGTAGGTTTCTCGTGTCGTGCCTGAGCTTTGCCCTTCTGTTGAGTGCAGTCTCGGCTCAGCTCAGGACGGATTTCTACAAGAACACGTGCCCGAACGTCGAGTCCCTCGTC
CGGTCGGCCGTGACCAAGAAGTTCCAGCAGACCTTCGTCACCGCCCCTGCAACTCTCCGCCTCTTGTTCCACGATTGCTTCGTCAGG
GTTGGTTTTGAAACAAAGTATTCTATACATAAT
AATGTTGGCTTAATTGTTAATTGTTTGCTTCTTCTTCTTATTTTTCGTTCGTTTTGTGGATTTGATTAGGGATGCGATGCTTCAGTGCTCATAGCGTCGCCCACCAACAATGCCGAGAAA
GACCATCCCGATGACCTGTCGCTCGCCGGCGACGGGTTCGACACTGTGATCAAAGCTAAGGCAGCAGTGGATAGTGTTCCTCAGTGCAAAAACAAAGTCTCTTGTGCCGATATCTTGGCT
CTTGCCACTAGAGATGTCGTTTCGTTG
GTACGATAGGGGCCCTCCACTAAACTCCTTTCCCAACTTTTTCATTTCACGAAATCGAGCATCCATCTAACTTTTTCAGTCCGGTGAAAAGCG
AACCATTCATATTGAGCTCGAAAATTTATGAAAAATTACTTTAGAGGCACGTAGTTTTCGAACCCTTATAGAGTGCTCGACTACTTTCTTAGAATATGCCAATATACTTTTCTTTTCCAC
TACATGACGAAATTATAATATGCTTTTGTTTTGTACGAAAGAAAAATAATAGTCTAATCATATAAACTTTTTAGTACAAATTTCTTTTCTTGTTACACTGAAAATCCATTGGGTCCCTTT
CATAACGGCTGTCCTTTTCTCCCTCCTCCACATCAATAGCATGTATGGAAGTTTGATGCAACGGGTTAACAAGAAAGTCGACAACAAGCACCACAACAAGCACCAACCAACGCTACTTTT
TCCTGTCAAACCACTCAAAATTGCGATTAATTTTCGTCCATTTTATTCTTTTCATTTTAGCAAATTGATAATGTCGCACGGTCATTTCATAATCACTTGCTATTCTTTGCAAAATTCTGA
AATTTTGTGTAGGCAGGGGGGCCGTTCTATAGTGTTGAATTGGGGAGACGCGATGGAAGAATATCAACTAAACTTGGTGTTCAACACAATCTTCCTCAGCCTGGTTCCAAATTGGACCAG
CTCAATTCTATGTTCTCTTCTCATGGTCTCTCCCAAACTGACATGATCGCCTTATCAG
GTAATTAATTACATCTTATTATGAGATTTGGTGGATTACTAAGCAAATAGATCAAGAGGCCA
TATAATTACATGCTAATCTCATGTTATTATTTTTTACTTAATCATTTTGAACCCTCAAAGCCATTCTTTTCGAAGAATTGTTTCAAAGCGTGACACAGAATTCTAAATTACAAAATTAAT
GCAGCATAAGCTCTAATTTTTTTTTTTTAATGTAATCTGCAAAATATACATGAAAGAGTAATTGGGTAAGTCGTCAAGTAAAGATGCATGACAACTTCCACTTTATGCAACACATCCTTG
TCTATCATCTAATTATCATCATAGGAAGCGGAAGAAAAGTGCTCATAGGTACCCAATGGCTTCTTATTGGAGCAATGTGCTCGACAACTAGGCAAGCATTGTAGTCCACTTGATTACCTA
AAGATTCCTTTATATAGCATATCATAGCTCAGATGATTGTAGTCTAATGTTAATCATAGTCCAATCATACTCTCTTTCATGATAGAATAGCATATGTAACTATTAAGCCGGTAGTCATCG
ACAAGTTCACAAAATTATTCAATTTCAAACGCTAAAGTTTGATTTTTCCCGGGTAACTCACATCGGAACCACTGCGTTTGTAGGCGCGCACACGATTGGATTCTCTCACTGCGGCAAATT
CTCCAAGCGGATCTACAACTTCAGCCCGAGAAGCTCGATCGATCCGACCCTGAACTTCCGCTACGCCTTGCAGCTGAGGCAGATGTGCCCGATCAACGTGGACCCCCGGATCGCCATCAA
CATGGACCCCACAACGCCTCAGACGTTCGACAACGCCTACTACAAGAACCTCCAACAAGGAAAGGGCCTCTTCGTCTCCGACCAGACATTGTTCTCCGACCCGAGGTCGAGGGCCACGGT
CAACCTGTTCGCATCAAACAACGCGGCGTTCCAACAGGCCTTCGTCACTGCGATCACAAAGATGGGTCGGATCGGGGTCAAGACTGGGAACCAGGGCGAGATTAGGATTGATTGCACTCG
CCCCAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGGCTCGTAGGTTTCTCGTGTCGTGCCTGAGCTTTGCCCTTCTGTTGAGTGCAGTCTCGGCTCAGCTCAGGACGGATTTCTACAAGAACACGTGCCCGAACGTCGAGTCCCTCGTC
CGGTCGGCCGTGACCAAGAAGTTCCAGCAGACCTTCGTCACCGCCCCTGCAACTCTCCGCCTCTTGTTCCACGATTGCTTCGTCAGG
GGATGCGATGCTTCAGTGCTCATAGCGTCGCCC
ACCAACAATGCCGAGAAAGACCATCCCGATGACCTGTCGCTCGCCGGCGACGGGTTCGACACTGTGATCAAAGCTAAGGCAGCAGTGGATAGTGTTCCTCAGTGCAAAAACAAAGTCTCT
TGTGCCGATATCTTGGCTCTTGCCACTAGAGATGTCGTTTCGTTG
GCAGGGGGGCCGTTCTATAGTGTTGAATTGGGGAGACGCGATGGAAGAATATCAACTAAACTTGGTGTTCAACAC
AATCTTCCTCAGCCTGGTTCCAAATTGGACCAGCTCAATTCTATGTTCTCTTCTCATGGTCTCTCCCAAACTGACATGATCGCCTTATCAG
GCGCGCACACGATTGGATTCTCTCACTGC
GGCAAATTCTCCAAGCGGATCTACAACTTCAGCCCGAGAAGCTCGATCGATCCGACCCTGAACTTCCGCTACGCCTTGCAGCTGAGGCAGATGTGCCCGATCAACGTGGACCCCCGGATC
GCCATCAACATGGACCCCACAACGCCTCAGACGTTCGACAACGCCTACTACAAGAACCTCCAACAAGGAAAGGGCCTCTTCGTCTCCGACCAGACATTGTTCTCCGACCCGAGGTCGAGG
GCCACGGTCAACCTGTTCGCATCAAACAACGCGGCGTTCCAACAGGCCTTCGTCACTGCGATCACAAAGATGGGTCGGATCGGGGTCAAGACTGGGAACCAGGGCGAGATTAGGATTGAT
TGCACTCGCCCCAACTAG

Retrieve as FASTA