Entry information : EgrPrx67 (Eucgr.C02212 / Egrandis_v1_0.019396m)
Entry ID 8084
Creation 2011-02-04 (Christophe Dunand)
Last sequence changes 2011-02-04 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-10-30 (Qiang Li)
Peroxidase information: EgrPrx67 (Eucgr.C02212 / Egrandis_v1_0.019396m)
Name (synonym) EgrPrx67 (Eucgr.C02212 / Egrandis_v1_0.019396m)
Class Class III peroxidase    [Orthogroup: Prx020]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx67
start..stop
S start..stop
EglPrx67 660 0 1..325 1..325
EguPrx68 658 0 1..325 1..325
EcamPrx67 657 0 1..325 1..325
EgrPrx68 654 0 1..325 1..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 40565907..40566113 207 N° 2 40566216..40566413 198 N° 3 40566987..40567152 166 N° 4 40567774..40568180 407
join(40565907..40566113,40566216..40566413,40566987..40567152,40567774..40568180 )


exon

Literature and cross-references EgrPrx67 (Eucgr.C02212 / Egrandis_v1_0.019396m)
DNA ref. Phytozome 12:   scaffold_3 (40565907..40568180)
Protein sequence: EgrPrx67 (Eucgr.C02212 / Egrandis_v1_0.019396m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (303)
PWM (Da):   %s   35450.05 (32970.7)  
PI (pH):   %s   9.48 (9.47) Peptide Signal:   %s   cut: 23 range:23-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEARRFLVSCLSFALLLSAVSAQLRTDFYKNTCPNVESLVRSAVTKKFQQTFVTAPATLRLLFHDCFVRGCDGSVLIASPTNNAEKDHPDDLSLAGDGFDTVIKAKAAVDSVPQCKNKVSCADILALAARDVVSLAGGPFYSVELGRRDGRISTKLSVQHNLPQPGSKLDQLNSMFSSHGLSQTDMIALSGAHTIGFSHCGKFSKRIYNFSPRSSVDPTLNFGYALQLRQMCPIKVDPRIAINMDPTTPQTFDNAYYKNLQQGKGLFVSDQTLFSDPRSRATVTLFASNNAAFRQAFVTAITKMGRIGVKTGNQGEIRIDCTRPN*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction from phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGGCTCGTAGGTTTCTCGTGTCGTGCCTGAGCTTTGCCCTTCTGTTAAGTGCAGTCTCGGCTCAGCTCAGGACGGATTTCTACAAGAACACGTGCCCGAACGTCGAGTCCCTCGTC
CGGTCGGCCGTGACCAAGAAGTTCCAGCAGACCTTCGTCACCGCCCCTGCAACTCTCCGCCTCTTGTTCCACGATTGCTTCGTCAGG
GTTGGTTTTGAAACAAAGTATTCTATACATAAT
AATGTTGGCTTGATTGTTAATTGTTTGCTTCTTGTTCTTCTTTTTCGTTCGTTTTGGGGATTTGATTAGGGATGCGATGGTTCAGTGCTCATAGCGTCGCCCACCAACAACGCCGAGAAA
GACCATCCCGATGACCTGTCGCTCGCCGGCGACGGGTTCGACACTGTGATCAAAGCTAAGGCAGCAGTGGATAGTGTTCCTCAGTGCAAAAACAAAGTCTCTTGTGCCGATATCTTGGCT
CTTGCCGCTAGAGATGTCGTTTCGTTG
GTACGATAAGGGCCCCCCACTGAACTCCTTTCCCAATTTTTTCATTTCACGAAATCGAGCATCCATCTAACTTTTTCAGTCCGGTGAAAAGCA
AACCATTCAAATTGAGCTCGAAAATTTATGAAAAATTACTTTAGAGGCACGTAGTTTTCGAACCCTTATAGAGTGCTCGACTACTTTCTTAGAATATGCCAATATGCTTTTCTTTTCCAC
GACATGACGAAATTATAATATGCTTTTGTTTTGTACCAAAGAAAAATAATAGTCTATTCATATAAAATTTTTAGTACAAATTTCTTTTCTTGTTACACTGAAAAACCATTGGGTCCCTTT
CATAATGCCTGTCCTTTTCTCCCTCCTCCACATCAATAGCATGTACGGAAGTTTGATGCAACGGGTTAACAAGAAAGTCGACAACAAGCACCACCCAACGCTACTTTTTCCCGTCAAACC
ACTCAAAATTGCGAATAATTTTCGTCCATTTTATTATTTTCATTTTAGCAAATTGATAATGTCGCACGGTCATTTCATAATCACTTGCTATTCTTTGCAAAATTTTGAAATTTTGTGTAG

GCAGGGGGGCCGTTCTATAGTGTTGAATTGGGGAGACGCGATGGAAGAATATCAACTAAACTTAGCGTCCAACACAATCTTCCTCAGCCTGGTTCCAAATTGGACCAGCTCAATTCCATG
TTCTCTTCTCATGGTCTCTCCCAAACTGACATGATCGCCTTATCAG
GTAATTAATTACATCTTATTACGAGATTTGGTGGATTACTAAGCAAATAGATCAAGAGACCACATAATTACTTG
CTAATCTCATATATATATTACTTAAGCATTTTGAACCCACAAAGCCATTCTTTTCGAAGAATTGTTTCTAAGCGTGACACAGAATTCTAAATTACAAAATTAATGCAGCATAAGCTCTAA
ATTTTTTTTTATAATGTAATTTGCAAAATATACATGAAAGAGTAATTGGGTAAGCCGTCAAGTAAAGATGCATGACAACTTCCACTTTATGCAACACATCCTTGTCTATCATCTAATTAT
AATCATAGGAAGCGGAAGAAAAGTGTTCATAGGTACCCAATGGCTTCTTATTGGAGCAATGTGCTAGACAACTAGGCAAGCCTTGTAGTCCACTTGATTACCTCTAGATTCATTTATATA
GCATATCATAGCTCAGACGATTGTAGTCTAATGTTTATCATAGTCCAATCATACTCTCTCTCATGATAGAATAGCATATGTAACTATTAAGCCGGTAGTCATTGACAAGTTCACAAAATT
ATTCAATTTCAAACGCTAAAGTTTGATTTTTCCCGGGTAACTCACATCGTAACCACTGCGTTTGTAGGCGCGCACACGATTGGATTCTCTCACTGCGGCAAATTCTCCAAGCGGATCTAC
AACTTCAGCCCGAGAAGCTCGGTCGATCCGACCCTGAACTTCGGCTACGCCTTGCAGCTGAGGCAGATGTGCCCGATCAAGGTGGACCCCCGGATCGCCATCAACATGGACCCCACAACG
CCTCAGACGTTCGACAACGCCTACTACAAGAACCTCCAACAAGGAAAGGGCCTCTTCGTCTCCGACCAGACATTGTTCTCCGACCCGAGATCGAGGGCCACGGTCACCCTGTTCGCATCA
AACAACGCGGCGTTCCGACAGGCCTTCGTCACTGCGATCACAAAGATGGGTCGGATCGGGGTCAAGACCGGGAACCAGGGTGAGATTAGGATTGATTGCACTCGCCCCAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGGCTCGTAGGTTTCTCGTGTCGTGCCTGAGCTTTGCCCTTCTGTTAAGTGCAGTCTCGGCTCAGCTCAGGACGGATTTCTACAAGAACACGTGCCCGAACGTCGAGTCCCTCGTC
CGGTCGGCCGTGACCAAGAAGTTCCAGCAGACCTTCGTCACCGCCCCTGCAACTCTCCGCCTCTTGTTCCACGATTGCTTCGTCAGG
GGATGCGATGGTTCAGTGCTCATAGCGTCGCCC
ACCAACAACGCCGAGAAAGACCATCCCGATGACCTGTCGCTCGCCGGCGACGGGTTCGACACTGTGATCAAAGCTAAGGCAGCAGTGGATAGTGTTCCTCAGTGCAAAAACAAAGTCTCT
TGTGCCGATATCTTGGCTCTTGCCGCTAGAGATGTCGTTTCGTTG
GCAGGGGGGCCGTTCTATAGTGTTGAATTGGGGAGACGCGATGGAAGAATATCAACTAAACTTAGCGTCCAACAC
AATCTTCCTCAGCCTGGTTCCAAATTGGACCAGCTCAATTCCATGTTCTCTTCTCATGGTCTCTCCCAAACTGACATGATCGCCTTATCAG
GCGCGCACACGATTGGATTCTCTCACTGC
GGCAAATTCTCCAAGCGGATCTACAACTTCAGCCCGAGAAGCTCGGTCGATCCGACCCTGAACTTCGGCTACGCCTTGCAGCTGAGGCAGATGTGCCCGATCAAGGTGGACCCCCGGATC
GCCATCAACATGGACCCCACAACGCCTCAGACGTTCGACAACGCCTACTACAAGAACCTCCAACAAGGAAAGGGCCTCTTCGTCTCCGACCAGACATTGTTCTCCGACCCGAGATCGAGG
GCCACGGTCACCCTGTTCGCATCAAACAACGCGGCGTTCCGACAGGCCTTCGTCACTGCGATCACAAAGATGGGTCGGATCGGGGTCAAGACCGGGAACCAGGGTGAGATTAGGATTGAT
TGCACTCGCCCCAACTAG

Retrieve as FASTA