Entry information : EgrPrx72 (Eucgr.C02751 / Egrandis_v1_0.019295m)
Entry ID 8085
Creation 2011-02-04 (Christophe Dunand)
Last sequence changes 2011-02-04 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-10-30 (Qiang Li)
Peroxidase information: EgrPrx72 (Eucgr.C02751 / Egrandis_v1_0.019295m)
Name (synonym) EgrPrx72 (Eucgr.C02751 / Egrandis_v1_0.019295m)
Class Class III peroxidase    [Orthogroup: Prx009]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx72
start..stop
S start..stop
EguPrx72 666 0 1..327 1..327
EcamPrx72 665 0 1..327 1..327
EglPrx72 665 0 1..327 1..327
EgrPrx71 598 0 1..327 1..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 52702298..52702522 225 N° 2 52702875..52703060 186 N° 3 52703291..52703456 166 N° 4 52703640..52704046 407
join(52702298..52702522,52702875..52703060,52703291..52703456,52703640..52704046 )


exon

Literature and cross-references EgrPrx72 (Eucgr.C02751 / Egrandis_v1_0.019295m)
DNA ref. Phytozome 11:   scaffold_3 (52702298..52704046)
Protein sequence: EgrPrx72 (Eucgr.C02751 / Egrandis_v1_0.019295m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328 (300)
PWM (Da):   %s   35804.51 (32649.9)  
PI (pH):   %s   8.54 (8.86) Peptide Signal:   %s   cut: 28 range:28-327
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MACPKLFLSCLLLELMFFFLVPEVAQGHSLKVGFYGKACPNAEAIVKEVIGQILSVAPSLSGPLLRLHFHDCFVRGCEGSVLLDSPTYQSEKYAFRKHGLRGYQEIDRVKTALEKACPGIVSCADILALVARDVVVATGGLFYDVETGRRDGYVSISEEARRDLIPPTANITTLKADFAKRGLSAKDLVILSGGHTIGNSHCSPFSNRLYNFTGKGDADPTLDSNYIARLKLSCKPNDQTTLVEMDPGSARTFDIKYFDLILKRRGLFTSDAALLDDNQTKAYLDFQIKTGGSTFFKDFGVSMVKMGRIGVLPKMAGEVRKVCTKVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction from phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTGTCCAAAGCTCTTCTTGTCTTGTTTGTTGCTTGAGTTGATGTTCTTTTTTCTTGTCCCTGAGGTTGCTCAAGGTCACAGTCTCAAAGTAGGGTTTTACGGGAAGGCATGCCCA
AACGCAGAGGCCATCGTGAAGGAAGTCATTGGCCAAATCTTGTCCGTCGCTCCGAGTCTTTCTGGCCCTCTTTTGAGATTGCATTTTCACGATTGCTTCGTTAGG
GTAAGTAAGAGAGCA
AGCTCCCATACTACTCGTCGTACTACGCGTTTGAAGTTTACCATTTTCTTATAACTTGACTAGTTGCTATAACTAATGTTCGGATAAACAGAGGGTGAGAAGTTAGACCCTGGGCTTTCA
TCTGAAGGGGTAATGCATGGCAGGGATGCGTCGAGATTTACTAAATAGGTTTACCTGATAACAATATGATAAAATGGAAAATGTGTCTTAGAACTAGTAATATACCAGTAAATGGTATTT
GGCTCTCAACATACTTCTCTAGATTCGTCTTTGGTTATGAGCTATTGTTTTCATGAACTCACGGTTGAATGATGCTTTGTTCTGGGTTTTTGCACAGGGCTGTGAAGGTTCGGTACTACT
GGACTCTCCGACCTATCAATCCGAGAAGTACGCCTTTCGAAAGCACGGCCTTCGAGGTTACCAAGAGATTGATAGAGTCAAAACAGCGTTGGAGAAGGCATGCCCTGGCATCGTTTCGTG
TGCTGACATCTTGGCCCTTGTCGCCAGAGACGTTGTCGTCGCG
GTGTGCCTATTCATAAATCATCTCAATATTTTATTATCAATTTGATTGTTTGTCACACCAGTACTACGTTAGTAGAA
TTCTCAATTTTTATCACACAGTCTACGTTATCACATTGGAAAACAAATTTGAGCCACACGTATCATAAAGGATAGGTACCGATAATTTTTTTAATGAGAAAAACATTTTTATATAGAAAT
TGGGGGTTTTCTTTTTTTGTGCTATCGCTTTAGACCGGAGGACTTTTCTATGACGTGGAAACCGGACGAAGAGATGGGTATGTTTCTATTTCGGAGGAGGCACGTAGGGATTTAATACCA
CCGACGGCCAACATTACAACTCTGAAAGCAGATTTTGCAAAGAGAGGCCTCAGTGCGAAGGACCTCGTTATCCTATCAG
GTAACACCTAATCTCCAATTACTGTTTTACATGCTTGTCAA
ATATATTGGATATATTGACATAAATTCATCAGGTAAAAAATTGTCATTTGAGCGTGAGATACATGAACGCAATCAGTGGTCCAGGGAGAAAATGTAATTTGTAAGGTAAGATCAATGTCG
ATTCTACTTTCCAATTGACCAGGTGGGCACACCATTGGAAATTCACACTGCTCTCCCTTCTCCAACCGCCTCTATAACTTCACCGGAAAGGGCGACGCCGACCCCACGCTCGACTCCAAC
TATATAGCAAGACTAAAGCTCAGTTGCAAGCCGAATGACCAAACCACTCTTGTCGAGATGGACCCGGGAAGTGCGAGAACGTTCGACATCAAATACTTCGATCTCATCTTGAAAAGAAGA
GGGCTCTTCACTTCGGACGCTGCACTTCTAGACGACAACCAAACCAAGGCGTACCTTGACTTCCAGATCAAGACCGGTGGATCCACTTTCTTCAAGGACTTTGGAGTGTCAATGGTGAAA
ATGGGTCGAATTGGCGTGCTCCCCAAAATGGCTGGTGAAGTCAGAAAAGTGTGTACAAAGGTCAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTGTCCAAAGCTCTTCTTGTCTTGTTTGTTGCTTGAGTTGATGTTCTTTTTTCTTGTCCCTGAGGTTGCTCAAGGTCACAGTCTCAAAGTAGGGTTTTACGGGAAGGCATGCCCA
AACGCAGAGGCCATCGTGAAGGAAGTCATTGGCCAAATCTTGTCCGTCGCTCCGAGTCTTTCTGGCCCTCTTTTGAGATTGCATTTTCACGATTGCTTCGTTAGG
GGCTGTGAAGGTTCG
GTACTACTGGACTCTCCGACCTATCAATCCGAGAAGTACGCCTTTCGAAAGCACGGCCTTCGAGGTTACCAAGAGATTGATAGAGTCAAAACAGCGTTGGAGAAGGCATGCCCTGGCATC
GTTTCGTGTGCTGACATCTTGGCCCTTGTCGCCAGAGACGTTGTCGTCGCG
ACCGGAGGACTTTTCTATGACGTGGAAACCGGACGAAGAGATGGGTATGTTTCTATTTCGGAGGAGGCA
CGTAGGGATTTAATACCACCGACGGCCAACATTACAACTCTGAAAGCAGATTTTGCAAAGAGAGGCCTCAGTGCGAAGGACCTCGTTATCCTATCAG
GTGGGCACACCATTGGAAATTCA
CACTGCTCTCCCTTCTCCAACCGCCTCTATAACTTCACCGGAAAGGGCGACGCCGACCCCACGCTCGACTCCAACTATATAGCAAGACTAAAGCTCAGTTGCAAGCCGAATGACCAAACC
ACTCTTGTCGAGATGGACCCGGGAAGTGCGAGAACGTTCGACATCAAATACTTCGATCTCATCTTGAAAAGAAGAGGGCTCTTCACTTCGGACGCTGCACTTCTAGACGACAACCAAACC
AAGGCGTACCTTGACTTCCAGATCAAGACCGGTGGATCCACTTTCTTCAAGGACTTTGGAGTGTCAATGGTGAAAATGGGTCGAATTGGCGTGCTCCCCAAAATGGCTGGTGAAGTCAGA
AAAGTGTGTACAAAGGTCAATTAA

Retrieve as FASTA