Entry information : EgrPrx73 (Eucgr.C04029 / Egrandis_v1_0.045800m)
Entry ID 8087
Creation 2011-02-04 (Christophe Dunand)
Last sequence changes 2011-02-07 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-12-04 (Qiang Li)
Peroxidase information: EgrPrx73 (Eucgr.C04029 / Egrandis_v1_0.045800m)
Name (synonym) EgrPrx73 (Eucgr.C04029 / Egrandis_v1_0.045800m)
Class Class III peroxidase    [Orthogroup: Prx030]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx73
start..stop
S start..stop
EglPrx73 661 0 1..326 1..326
EcamPrx73 660 0 1..326 1..326
EguPrx73 652 0 1..326 1..326
RcPrx44 506 0 5..326 7..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 74949799..74950017 219 N° 2 74949000..74949179 180 N° 3 74948747..74948912 166 N° 4 74947899..74948314 416
complement(join(74947899..74948314,74948747..74948912,74949000..74949179,7494979 9..74950017))


exon

Literature and cross-references EgrPrx73 (Eucgr.C04029 / Egrandis_v1_0.045800m)
DNA ref. Phytozome 12:   scaffold_3 (74950017..74947899)
Protein sequence: EgrPrx73 (Eucgr.C04029 / Egrandis_v1_0.045800m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327 (300)
PWM (Da):   %s   35041.67 (32041.1) Transmb domain:   %s   i5-24o
PI (pH):   %s   6.24 (5.73) Peptide Signal:   %s   cut: 27 range:27-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
METRVFTLNHLIFLVFFLAHVVASSAQLSFGFYAASCPAAESIVRNTVRSASSSDPTIPGKLLRLLFHDCFVEGCDASVLIRGNGTEQNDPANTSLGGFSVIDSAKRVLELFCPGTVSCADIIALAARDAVELTGGPAVQIPTGRKDGRVSAASNVRPNIVDTSFTINEMIKLFSSKGLSLADLVALSGAHTIGAAHCSAFSDRFQADSKGKFTLIDSSLDKNYAEELMRRCPAGASPSITVNNDPETSLSFDNQYYRNLLLHKGLFQSDSVLVKDNRTREKVENFANDQDSFFASWAQSFLKLSVVEVKTGNAGEVRQSCSLING*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from Phytozome (5' end is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGACCAGAGTTTTCACATTGAATCATCTCATTTTTCTCGTCTTCTTCCTAGCTCACGTGGTTGCCTCTTCCGCTCAGCTGTCTTTTGGCTTCTATGCTGCTTCATGTCCTGCTGCT
GAATCCATAGTCAGGAACACAGTGAGATCAGCTTCTTCCAGTGACCCCACAATCCCTGGGAAGCTCCTTCGATTACTCTTTCATGACTGCTTCGTGGAG
GTTAGTCTTCTTCTCTTCATT
GCTCACTTTAGAAAGAGACAGATTCTTGTAATCATGAAACTCGTGCAAAGAATGTACTTCATGCCTCCTAGTATCCAATGGACAGCTTCGCATAATGTTTCTACTGTGAACTTTATTGGG
TTCCTACGGACGGAAATTTTAGCCAAGTTTGACTTATGTTTATTGAATCTGTATAATTCCATTTTAGCCAAAGGAAATTTAAAGCTCAAGACAGCGACTCAAATGTTCCTTTGCTTCTAG
TGTTTGGCCAAGGAAGAAGATCTCATGAACTTTATAGGAAGTCCTGAAGAAGTGAGAAATCTTTCTGAGGTCATAATGGATGAATTATCCGTGGAAACTGAGAAGATAGTGACAGTCATT
TCAAATACTACAGGCTTACTTTCTTCAAGCAATCTATGTTCCTAAATGCAAAGAGAAGTCTCTCCAGTCATCATCGTGTATGAAATTATTCACTTGTAAATTTTCCTGTGTGCGGTCTTG
CTGACACTTCATGCTTCTCCTGAGTCTGTCTCCTAACTTAAGCCAAGAAGTTAGGCCTGTTTCTGAAGTGACTATAATTTCAATATCAATTTGACTGATTACTATGATATGGTAGTAGGG
TTGCGATGCATCCGTGCTTATACGAGGAAATGGAACAGAGCAAAATGATCCAGCTAATACATCACTTGGAGGATTTTCTGTCATAGACTCAGCTAAAAGGGTTTTAGAATTATTCTGTCC
AGGAACCGTTTCTTGCGCCGATATAATTGCATTAGCTGCCAGGGATGCTGTTGAACTG
GTAATGCAGATTCTCAATACTACCTTTTGCCTTTCCAAATTTTTTAGTACAAGGTTTTTGCA
CTGAATTATGCATGCTTCAATGCAGACTGGAGGGCCTGCAGTTCAGATTCCAACAGGTAGGAAAGATGGGAGAGTTTCTGCAGCTTCAAATGTAAGACCCAACATCGTGGATACAAGTTT
TACAATCAACGAGATGATTAAACTCTTCTCGTCTAAGGGGCTGTCCTTGGCTGATCTTGTCGCACTGTCAG
GTATAACTGGAATATATCAGCTCCTAAAAGCAAAACAAGGTCAAGAACA
GTTAGTAGTGCGGGCACCATGTTCGGAAAATTTCCCTAAGAGTAGTTGTTAACAAAAATATTGATTTTTGGGTCATTTCTTTTCTAATGAAATAATAACGACAATGCAAAGGACTTTTCT
TCTTATAGCTGGAATCACATGAACAAAATATTCCCAGGTACTTGCATTCCCCTGACCATCAGAAAAGGAAACGGATTCGAGTCAATGGGAAATTTTGGGATTGATGGGTCAACGAAAAAG
TTAGAATTGTGGATAACAAATCACTTAGGCAAATCCTAGTTGCTAGTTCATGAAATGGAGGAAGTAAGGTTTAGTTTTAAAGACAAGACCATTGGAGCATCCATTGCCTACAGTTGGTAA
TATTATGTGCTTTGAGGTGACAGGTGCACATACCATAGGAGCGGCTCACTGCAGTGCATTCAGCGACAGATTCCAAGCTGACTCCAAGGGGAAGTTCACCCTAATTGACTCATCCCTCGA
CAAGAATTATGCAGAGGAACTCATGAGACGGTGCCCTGCAGGTGCTAGTCCTTCCATTACAGTTAACAACGACCCTGAAACATCCTTGTCATTTGACAATCAGTACTACCGAAATCTCTT
GTTGCACAAGGGGCTATTTCAGTCAGATTCTGTACTGGTAAAGGATAACAGAACAAGGGAGAAAGTAGAGAATTTCGCGAATGACCAGGACAGTTTCTTTGCAAGCTGGGCTCAGTCATT
CTTGAAGCTCAGTGTAGTTGAAGTAAAAACAGGCAATGCGGGGGAGGTGAGACAATCTTGCTCACTTATTAACGGGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGACCAGAGTTTTCACATTGAATCATCTCATTTTTCTCGTCTTCTTCCTAGCTCACGTGGTTGCCTCTTCCGCTCAGCTGTCTTTTGGCTTCTATGCTGCTTCATGTCCTGCTGCT
GAATCCATAGTCAGGAACACAGTGAGATCAGCTTCTTCCAGTGACCCCACAATCCCTGGGAAGCTCCTTCGATTACTCTTTCATGACTGCTTCGTGGAG
GGTTGCGATGCATCCGTGCTT
ATACGAGGAAATGGAACAGAGCAAAATGATCCAGCTAATACATCACTTGGAGGATTTTCTGTCATAGACTCAGCTAAAAGGGTTTTAGAATTATTCTGTCCAGGAACCGTTTCTTGCGCC
GATATAATTGCATTAGCTGCCAGGGATGCTGTTGAACTG
ACTGGAGGGCCTGCAGTTCAGATTCCAACAGGTAGGAAAGATGGGAGAGTTTCTGCAGCTTCAAATGTAAGACCCAACATC
GTGGATACAAGTTTTACAATCAACGAGATGATTAAACTCTTCTCGTCTAAGGGGCTGTCCTTGGCTGATCTTGTCGCACTGTCAG
GTGCACATACCATAGGAGCGGCTCACTGCAGTGCA
TTCAGCGACAGATTCCAAGCTGACTCCAAGGGGAAGTTCACCCTAATTGACTCATCCCTCGACAAGAATTATGCAGAGGAACTCATGAGACGGTGCCCTGCAGGTGCTAGTCCTTCCATT
ACAGTTAACAACGACCCTGAAACATCCTTGTCATTTGACAATCAGTACTACCGAAATCTCTTGTTGCACAAGGGGCTATTTCAGTCAGATTCTGTACTGGTAAAGGATAACAGAACAAGG
GAGAAAGTAGAGAATTTCGCGAATGACCAGGACAGTTTCTTTGCAAGCTGGGCTCAGTCATTCTTGAAGCTCAGTGTAGTTGAAGTAAAAACAGGCAATGCGGGGGAGGTGAGACAATCT
TGCTCACTTATTAACGGGTGA

Retrieve as FASTA