Entry information : EgrPrx[P]40
Entry ID 8089
Creation 2011-02-04 (Christophe Dunand)
Last sequence changes 2012-02-16 (Qiang Li)
Sequence status theoretical translation / pseudogene
Reviewer Christophe Dunand
Last annotation changes 2016-03-13 (Christophe Dunand)
Peroxidase information: EgrPrx[P]40
Name EgrPrx[P]40
Class Class III peroxidase    [Orthogroup: N/D] N/D
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx[P]40
start..stop
S start..stop
EguPrx[P]40 243 4e-85 1..131 1..131
EglPrx[P]40 209 4e-72 1..131 1..109
EglPrx32 212 3e-70 1..131 1..132
EgrPrx32 212 3e-70 1..131 1..132
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 11260100..11260324 225 N° 2 11259814..11259981 168  
complement(join(11259814..11259981,11260100..11260324))


exon

Literature and cross-references EgrPrx[P]40
DNA ref. Phytozome 12:   scaffold_1 (11260324..11259814)
Protein sequence: EgrPrx[P]40
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   131 (108)
PWM (Da):   %s   14324.37 (11975.1)  
PI (pH):   %s   6.91 (6.49) Peptide Signal:   %s   cut: 24 range:24-131
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALGSLSLFRALLFLSLSASALSTRPYNNGLSPHYDYECPQALATIKRVIEEMVQQERRMGASLLRLHFHDCFVNGRDALMLLDPTLAIDNEKLALHNNNSARGFKVIVQIKAEVDGVCGCLVVSCAEILA

Retrieve as FASTA  
Remarks Pseudogene from genomic (exons 1 and 2). No prediction from Phytozome. No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTAGGTAGCCTCAGCCTCTTCCGAGCACTTCTCTTCTTGTCCCTCTCGGCGTCAGCTCTCTCGACGCGCCCCTACAACAACGGCCTCTCGCCACACTATGACTATGAATGCCCT
CAAGCCTTAGCCACCATCAAGCGCGTCATTGAGGAGATGGTGCAGCAAGAGCGACGCATGGGTGCGTCCTTGCTGCGCTTGCACTTCCACGACTGTTTCGTCAAT
CGAAGACATATACAG
CTAAATTTCACATTAATTTGTTGTTCTAAAAAATAGTGATTACTATTTAGCATTGCACAATACTTGCTAACATTGATGTTTGTTTGGGAGTTCAATAATGCAGGGCCGTGATGCATTGAT
GCTCTTGGATCCGACCCTGGCCATCGACAATGAAAAGCTTGCGCTTCATAATAACAATTCAGCTAGAGGGTTCAAAGTGATCGTCCAAATTAAGGCGGAGGTTGACGGAGTATGTGGATG
TCTGGTGGTATCTTGTGCGGAAATCTTGGCA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTAGGTAGCCTCAGCCTCTTCCGAGCACTTCTCTTCTTGTCCCTCTCGGCGTCAGCTCTCTCGACGCGCCCCTACAACAACGGCCTCTCGCCACACTATGACTATGAATGCCCT
CAAGCCTTAGCCACCATCAAGCGCGTCATTGAGGAGATGGTGCAGCAAGAGCGACGCATGGGTGCGTCCTTGCTGCGCTTGCACTTCCACGACTGTTTCGTCAAT
GGCCGTGATGCATTG
ATGCTCTTGGATCCGACCCTGGCCATCGACAATGAAAAGCTTGCGCTTCATAATAACAATTCAGCTAGAGGGTTCAAAGTGATCGTCCAAATTAAGGCGGAGGTTGACGGAGTATGTGGA
TGTCTGGTGGTATCTTGTGCGGAAATCTTGGCA

Retrieve as FASTA