Entry information : EgrPrx25
Entry ID 8093
Creation 2011-02-04 (Christophe Dunand)
Last sequence changes 2011-02-04 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-02-15 (Qiang Li)
Peroxidase information: EgrPrx25
Name EgrPrx25
Class Class III peroxidase    [Orthogroup: Prx010]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx25
start..stop
S start..stop
EglPrx25 648 0 1..319 1..319
EcamPrx25 615 0 1..319 1..322
EguPrx25 608 0 1..319 1..319
EcamPrx24 593 0 1..319 1..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 11071561..11071776 216 N° 2 11073268..11073459 192 N° 3 11073579..11073744 166 N° 4 11073849..11074234 386
join(11071561..11071776,11073268..11073459,11073579..11073744,11073849..11074234 )


exon

Literature and cross-references EgrPrx25
DNA ref. Phytozome 12:   scaffold_1 (11071561..11074234)
Protein sequence: EgrPrx25
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   319 (294)
PWM (Da):   %s   33692.43 (31096.1) Transmb domain:   %s   i12-34o
PI (pH):   %s   6.64 (6.65) Peptide Signal:   %s   cut: 26 range:26-319
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MACENSSPRSAFLLLLCFLLGTASARLSSTFYFTSCPSALHTIKSGVNSAVSSEARMGASLLRLHFHDCFVNGCDASILLDDTTNFTGEKTAGANDNSIRGYEVIDTIKSQLESSCPGVVSCADILAVAARDSIVALGGPSWRVLLGRRDSTTASLSAANSDIPAPTLSLSDLITAFSNKGFTAKEMVALSGSHTIGQARCTTFQTRLYNESDINSTFATSLKENCPSSGGDNNLSPLDTTSPTYFDNAYFKNLQTQKGLLHSDQQLFSGGSTDAQVNTYSSNSATFMTDFANAMVKMGNLSPLTGSSGQIRKNCRKLN

Retrieve as FASTA  
Remarks Complete sequence from genomic. No prediction from phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTGCGAGAACTCTTCTCCCAGATCCGCCTTCTTATTGTTGCTGTGTTTCCTACTTGGAACAGCCTCGGCTCGGCTGTCCAGCACTTTCTACTTCACATCCTGTCCCAGCGCCCTC
CACACCATTAAGTCCGGCGTGAACTCCGCAGTGTCCAGCGAGGCCCGCATGGGCGCCTCACTGCTCCGCCTTCACTTCCACGATTGCTTCGTCAAT
GCAAGTCCCTCTCCTCCGAGTCTC
TCCTCTCTTTCCCTTTGATTTCTACCTTTGTTTCTCTTCTGTCATTCAAGCTGCATGCAAGCGTGCGTGCATGATGCATCTTTATGCCTGTGCTTGTGAAACATTCCAACCACCCTCATA
GTCAAAGGCATCATTAGATTTCGCTTCTACGCAATTAATGTACTCTCTTTTTCGCTAATTAAAACAGTAGGTACGAGATTCGCATATTGAATTAGTCGAGTCTGACCGACCTTTTTGGTG
TATTGTTGTGCCATGCATTTTTGTGAGTTTATCAAAGGTGGACAAGAATGTTGTTGTGTATACTCTTAATTTTTTTATTACAGAGACAATATATGCTATAATTTTCTTTATTATAAAAGC
CATGCAGGCGACGTACTTTATGCTGATCACGCTGTTGATAAGATGTGCATGTATGATTAGCTACCTGTTTTAAACCCGATGAACTCGATGATTTAGATCATGAAAAAGTCCTAAACGTTG
CAGCTGTAAAAAAAGAAGAGAGAGACGGCCATGCTTTTTAAGTCAAATACGCGTTTATCACGTTTGGCAAAACCAATCAGTCTTTCTCAATAGGTTTCAATCATATTTTGATCACCATCC
CTTTGGTTGCCATACTTTTCTAAATTTAAAATGATATTTTATGGTAAAATATCAGTTTTAATGGAATTTGTTAATCCAATGGTATTCTAAAAATCATATTAGATCTTTGAATAAATGAAT
TTCGCCTTGTGCATGGCCTCACTAGTTTGCTTCCAACACAAATTTAGAGTGTCAATCTAAATTAACTAATTGATTTAGTGTACCTTCTTTGTGTTCTTTGTGCATAATGTAAGAGTTGCT
TGCATCCTAATGGATCTTTCTCCATCAAACATGCCGTCTCTACTTTGATCTTGATATTCATAGGCTGATCTATTTTTTAAATAACAAATATGACATGTTTACAACTTTCTCGGTTAGATT
TGTGGGTTGCTTTTCTTTTTCCTATATAGGTTGGAAATTGTCTAGATTTTCATTTTTGATCGATACATAATTGGTCATTCGAGAAGGCCAAACTTAGGCTAATTCTAGTGAATCATAAAG
TCGGTGACTCCCCTCTGTTATATATTAAAGAACGCGCCATGTTGCAAACCAAAAATCTTGATTTAGAGAACTCTTCACAGCGCAATCATTTTGTTTCTAGTCCGACGATTATTGGATGCA
TTGTTCCTTGAGAAACAATAGGGAGTAAAGTCAAAAGGCATGAGCAAGAGTGTCACCTTCGTCCAGATTGGTGTCTCTAGTCGTTGATAGTGGGGGACAAAAAGGGGGAATGATAAGGGA
AACAACCAGTGTTTATGCTCTCATTTCAGGAAAATTTATAACAACCAAACCTCCTGTCTACAACCAATGAATGAAATGAACGCCAATTGGATCGATTTTCCAACTAGAAGGGCTGATTAA
TAATGTGTGGTGCAAAATATGAAACAGGGATGTGACGCGTCGATTCTGTTGGACGACACCACGAACTTCACTGGGGAGAAGACCGCCGGCGCGAATGACAATTCCATACGTGGATACGAG
GTGATCGACACGATCAAGTCCCAACTGGAGAGCAGCTGCCCTGGGGTCGTGTCCTGTGCTGACATCTTGGCCGTCGCCGCGCGTGATTCTATTGTTGCC
GTAAGTGCACATTTTCTTCTC
AACACTAGCAATCAATTGGGAGGAAAAAATCACATGCTATGTTACCTTTCTATATTAGCACTAACATGTTTGGATTTATTTGTTTATTTAATTTTCAGTTAGGTGGCCCAAGTTGGAGAG
TCTTATTAGGAAGAAGAGACTCGACCACCGCAAGCCTAAGTGCTGCTAATAGCGACATTCCTGCCCCAACTTTGAGCCTTAGCGACCTCATCACCGCCTTCTCTAACAAAGGCTTCACTG
CCAAAGAAATGGTGGCACTTTCAG
GTCTTTCTTTTTTTTTTGGTTGCATTTTATAATAAAGAATTATAATAAAGCTCGACTGATATACCAAGATCGATTTACAAAAACTGTTCAATTGTT
GTCAATAGGATCGCACACGATAGGTCAAGCCCGATGCACAACTTTCCAGACCCGGCTTTATAATGAGAGCGACATCAACAGCACGTTCGCAACGTCACTAAAAGAAAACTGCCCAAGCTC
CGGAGGTGACAACAATCTCTCTCCTCTCGACACCACAAGCCCGACGTACTTCGACAACGCCTACTTCAAGAATTTGCAGACCCAAAAGGGGCTTCTTCACTCGGACCAGCAATTGTTCAG
TGGTGGTTCCACAGACGCTCAAGTGAACACTTACAGTAGCAATTCGGCTACTTTCATGACAGATTTTGCTAACGCCATGGTGAAGATGGGTAACCTCAGCCCACTCACCGGCTCAAGCGG
TCAGATTAGGAAGAACTGCAGGAAACTCAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTGCGAGAACTCTTCTCCCAGATCCGCCTTCTTATTGTTGCTGTGTTTCCTACTTGGAACAGCCTCGGCTCGGCTGTCCAGCACTTTCTACTTCACATCCTGTCCCAGCGCCCTC
CACACCATTAAGTCCGGCGTGAACTCCGCAGTGTCCAGCGAGGCCCGCATGGGCGCCTCACTGCTCCGCCTTCACTTCCACGATTGCTTCGTCAAT
GGATGTGACGCGTCGATTCTGTTG
GACGACACCACGAACTTCACTGGGGAGAAGACCGCCGGCGCGAATGACAATTCCATACGTGGATACGAGGTGATCGACACGATCAAGTCCCAACTGGAGAGCAGCTGCCCTGGGGTCGTG
TCCTGTGCTGACATCTTGGCCGTCGCCGCGCGTGATTCTATTGTTGCC
TTAGGTGGCCCAAGTTGGAGAGTCTTATTAGGAAGAAGAGACTCGACCACCGCAAGCCTAAGTGCTGCTAAT
AGCGACATTCCTGCCCCAACTTTGAGCCTTAGCGACCTCATCACCGCCTTCTCTAACAAAGGCTTCACTGCCAAAGAAATGGTGGCACTTTCAG
GATCGCACACGATAGGTCAAGCCCGA
TGCACAACTTTCCAGACCCGGCTTTATAATGAGAGCGACATCAACAGCACGTTCGCAACGTCACTAAAAGAAAACTGCCCAAGCTCCGGAGGTGACAACAATCTCTCTCCTCTCGACACC
ACAAGCCCGACGTACTTCGACAACGCCTACTTCAAGAATTTGCAGACCCAAAAGGGGCTTCTTCACTCGGACCAGCAATTGTTCAGTGGTGGTTCCACAGACGCTCAAGTGAACACTTAC
AGTAGCAATTCGGCTACTTTCATGACAGATTTTGCTAACGCCATGGTGAAGATGGGTAACCTCAGCCCACTCACCGGCTCAAGCGGTCAGATTAGGAAGAACTGCAGGAAACTCAACTGA

Retrieve as FASTA