Entry information : EgrPrx53 (Eucgr.A02459 / Egrandis_v1_0.018850m)
Entry ID 8097
Creation 2011-02-04 (Christophe Dunand)
Last sequence changes 2011-02-07 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-10-30 (Qiang Li)
Peroxidase information: EgrPrx53 (Eucgr.A02459 / Egrandis_v1_0.018850m)
Name (synonym) EgrPrx53 (Eucgr.A02459 / Egrandis_v1_0.018850m)
Class Class III peroxidase    [Orthogroup: Prx057]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx53
start..stop
S start..stop
EguPrx51 686 0 1..334 1..334
EglPrx53 686 0 1..334 1..334
EgrPrx54 677 0 1..334 1..334
EcamPrx53 674 0 1..334 1..334
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 35254045..35254272 228 N° 2 35254405..35254596 192 N° 3 35254723..35254888 166 N° 4 35256345..35256763 419
join(35254045..35254272,35254405..35254596,35254723..35254888,35256345..35256763 )


exon

Literature and cross-references EgrPrx53 (Eucgr.A02459 / Egrandis_v1_0.018850m)
DNA ref. Phytozome 12:   scaffold_1 (35254045..35256763)
Protein sequence: EgrPrx53 (Eucgr.A02459 / Egrandis_v1_0.018850m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   335 (305)
PWM (Da):   %s   36135.12 (33055.4) Transmb domain:   %s   i7-29o
PI (pH):   %s   6.61 (5.93) Peptide Signal:   %s   cut: 30 range:30-334
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARSSTLSSPTVVALFAAALLFLLHPLNAELTADFYAKTCPDVSSIVQTVIHEALQYDPRITASLLRLHFHDCFVQGCDGSVLLDNSPTIKSEKDAAPNFNSARGFGVVDKIKAAIESTCPETVSCADILALAANASVYLSGGPYWTVLLGRRDSLTANQGLANTSIPSPFESYANLTSKFYVLGLDITDLVTLSGAHTFGRAHCKSFTPRLYNFTKNGGPDPTLSPWYLTALQKLCPPNFNPKVITDLDPTTPNLFDNHYYSNLQKNDGLFETDQELYSTAGAATVPIVNSFSADQSAFFKSFTRSIVNMGNISPLTGSNGEIRCNCRKVNKS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (scaffold_1: 35254008 - 35256987, Egrandis_v1_0.018850m), It very similar to EgraPrx107 (scaffold_1:35,263,534..35,266,207, Egrandis_v1_0.018837m). Correct prediction from phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCCGTTCTTCTACTCTTTCGTCACCAACGGTGGTGGCCCTTTTTGCCGCCGCCTTGTTGTTTCTCCTCCATCCATTGAATGCTGAACTAACCGCTGATTTTTATGCAAAGACATGC
CCGGACGTGTCCAGCATCGTCCAGACCGTGATTCATGAGGCCCTTCAATATGACCCACGCATCACCGCCAGCCTCCTCCGTCTCCATTTCCACGATTGCTTCGTCCAG
GTGAGTCCCTAC
ACTAGATCAATTCCCATTGACAATGAGTTCCAACTTACCGCATTCTTTTTACAGTACTTTCGATCTGATTATCGAGTTATTAGTCACGTAACCTAATGCTTGAGCATGACGTGTTTAAAG

GGGTGTGATGGATCGGTATTGCTGGACAATAGCCCAACCATAAAGAGCGAGAAAGATGCTGCTCCGAATTTTAATTCCGCAAGAGGGTTCGGTGTGGTGGACAAGATCAAAGCGGCTATT
GAGAGCACTTGTCCTGAGACTGTGTCTTGCGCTGACATCCTCGCCTTGGCTGCTAACGCTTCCGTTTATTTG
GTATGTGTCGTTTTAGTCAAAGAAACATAAAACATATTTAAAGTATAC
TTAGGATTCATTATTGTCACTTGGCCTACACGAATTATAATTGTGTTTCTCTTGATTATCACATTTATGAAATTGCAGTCAGGAGGTCCATATTGGACGGTGCTCTTGGGGAGGAGGGAC
AGCTTGACGGCGAACCAAGGACTAGCGAACACATCGATACCCTCCCCTTTTGAGAGCTATGCCAACCTCACTTCCAAGTTCTATGTTTTGGGCTTGGACATCACCGACCTTGTCACACTT
TCCG
GTAAAACAGAACAGTTGGACTTGCATTTTGATACGAACATGCAACTACAGATATTGATGCACAAAATAGATTAACAGAGTGAAATGTCGGATTTTTGTCACATAAGTTATCGGCAC
AAACATCGCATCACTTTCATTTAGCACATTTCAACTTCCTAATATGATCAAGGTCTCTTCTTCATTGAGATCAACTGACAGGCATGGGCTGTGCATGTGCATGGGCCGTGCCCCGGCAAT
GCTATCTACTAGAAGGAATTTTAGTCAAGGATTAAGGGTTAAATTTTTTTTTTATCTAAAATTGAATTTAAGTAAAGAATCGTCCTAAAACATGTGATCGACTAAAGTGCATGTGTTGTG
CCTAGGCTGTACCTGGGTCGTGCATGGGCTATGCACATTTACTAGAAGGAATTTTGACTGAGGATTAATGATTTCTTTTTTACCAAAAATTGAAAAAGTAAAGGATTGCCCTTCACTTGA
GATCAACTGACGTGCATGCGTTGTGCCTGGGCCATGCCATGTTGTGCATGGGTATATAGATATATTAGAAGGAAGTTTAGCTAAAGGATTAAGGGTTTCTTTTCAATCTAAAATTGAATA
AGTAAAGGATTGCCCCGACTTAATTTCAGGAGTAGTTGTGTATCATCACTACTCTAAAAAAGATAGATTATTTAAAAACAATTTTTTGCATGACCGAGACTTATCTCCTCGGTAAATTCA
AAAAGGAGAGGAAGCCGATGATATGCAATTTCATTAAATTAGAAATTATGGGTTCATACATTTGCAGGTCCATAATTTGCTAGTCCTTGATAAAAATGGTAATTCAATAGGGTTAGTTTG
ATTGAACTGAATGAGTATAGTTAAAATCTCCTTGCGTGGATCCCACTTATCTTTAATTCAAATGGATCTAAATCAAGCCCGTATCAGCAACTCTTTAAGTCTTATCTAGTATAACTTCTG
CTATCAAGACGAAGAAGTGGTCAATGATGACACTTCATCGTTCAATTCATGATGAGGTTCATAGCGTTGAAACCATCGAATTAATGTAATATTTTCTTTGTTGTGATTTGTTTTCAATCA
AACTAGTGTACTTTTATGTGTAATTTTTTTATTACAAATTTGAAAAATATATTCGTGTTCAATGGGTAATTTTATATTCCTAATATCATTACAAGAGTATAAATATTGGAGGAGGATGCT
ATCAAAATTTGCATGCCCCTCACATACTTGTATGAGAAATGCCAAGTATACTGAGGTCATTTGATAGAATCAATAAAATAAGTGATGTCACATATCACTATTATTTATTTATATTTTTAC
TAACGAGTGTGTTGCATATGTTTAGTATACAAATTCTATTAAGCATTCCTAGTATTGGTCTATTTATCCACCTTCACAATTGAGCTATGCAGATATTTTGTTCTCTTAGCTAATTATTCG
TGCATATGATAATAAAACAGGAGCTCACACCTTTGGACGTGCACATTGCAAGTCATTCACCCCTAGGCTGTACAACTTCACCAAAAATGGTGGCCCCGATCCCACCCTAAGCCCGTGGTA
CTTGACGGCTCTCCAGAAACTTTGCCCTCCAAACTTCAATCCTAAAGTCATCACCGACCTCGATCCGACGACCCCGAACTTGTTTGACAACCACTACTACTCCAACCTCCAGAAAAATGA
CGGGCTTTTTGAGACTGATCAAGAGCTGTACTCGACAGCCGGTGCTGCGACAGTACCCATCGTCAACAGCTTCAGTGCCGACCAGAGTGCCTTCTTCAAGAGCTTCACTCGGTCGATAGT
AAACATGGGAAACATAAGTCCTCTCACCGGAAGTAACGGGGAGATCAGGTGCAATTGCAGGAAGGTCAATAAGAGTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCCGTTCTTCTACTCTTTCGTCACCAACGGTGGTGGCCCTTTTTGCCGCCGCCTTGTTGTTTCTCCTCCATCCATTGAATGCTGAACTAACCGCTGATTTTTATGCAAAGACATGC
CCGGACGTGTCCAGCATCGTCCAGACCGTGATTCATGAGGCCCTTCAATATGACCCACGCATCACCGCCAGCCTCCTCCGTCTCCATTTCCACGATTGCTTCGTCCAG
GGGTGTGATGGA
TCGGTATTGCTGGACAATAGCCCAACCATAAAGAGCGAGAAAGATGCTGCTCCGAATTTTAATTCCGCAAGAGGGTTCGGTGTGGTGGACAAGATCAAAGCGGCTATTGAGAGCACTTGT
CCTGAGACTGTGTCTTGCGCTGACATCCTCGCCTTGGCTGCTAACGCTTCCGTTTATTTG
TCAGGAGGTCCATATTGGACGGTGCTCTTGGGGAGGAGGGACAGCTTGACGGCGAACCAA
GGACTAGCGAACACATCGATACCCTCCCCTTTTGAGAGCTATGCCAACCTCACTTCCAAGTTCTATGTTTTGGGCTTGGACATCACCGACCTTGTCACACTTTCCG
GAGCTCACACCTTT
GGACGTGCACATTGCAAGTCATTCACCCCTAGGCTGTACAACTTCACCAAAAATGGTGGCCCCGATCCCACCCTAAGCCCGTGGTACTTGACGGCTCTCCAGAAACTTTGCCCTCCAAAC
TTCAATCCTAAAGTCATCACCGACCTCGATCCGACGACCCCGAACTTGTTTGACAACCACTACTACTCCAACCTCCAGAAAAATGACGGGCTTTTTGAGACTGATCAAGAGCTGTACTCG
ACAGCCGGTGCTGCGACAGTACCCATCGTCAACAGCTTCAGTGCCGACCAGAGTGCCTTCTTCAAGAGCTTCACTCGGTCGATAGTAAACATGGGAAACATAAGTCCTCTCACCGGAAGT
AACGGGGAGATCAGGTGCAATTGCAGGAAGGTCAATAAGAGTTGA

Retrieve as FASTA