Entry information : AtPrx05 (At1g14550 / PER5)
Entry ID 81
Creation 2006-02-02 (Filippo Passardi)
Last sequence changes 2015-06-02 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-11-09 (Achraf Jemmat)
Peroxidase information: AtPrx05 (At1g14550 / PER5)
Name (synonym) AtPrx05 (At1g14550 / PER5)
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtPrx05
start..stop
S start..stop
AlyPrx05 637 0 1..321 1..321
AhalPrx57 634 0 1..321 1..321
BstrPrx37 632 0 1..321 1..321
CrubPrx88 616 0 1..321 1..321
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4979028..4979240 213 N° 2 4979326..4979517 192 N° 3 4979607..4979775 169 N° 4 4979933..4980324 392
join(4979028..4979240,4979326..4979517,4979607..4979775,4979933..4980324)


exon

Literature and cross-references AtPrx05 (At1g14550 / PER5)
Protein ref. UniProtKB:   Q9M9Q9
DNA ref. Phytozome 12:   Chr1 (4979028..4980324)
mRNA ref. GenBank:   NM_101322
Cluster/Prediction ref. Phytozome Gene 12:   19651856
Omic ref. AtProteome:   At1g14550 ATTED-II:   At1g14550 e-FP Browser:   At1g14550 ePlant:   At1g14550 Genevestigator:   At1g14550 TAIR:   At1g14550
Protein sequence: AtPrx05 (At1g14550 / PER5)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   321 (297)
PWM (Da):   %s   34870.68 (32114.3)  
PI (pH):   %s   8.79 (8.73) Peptide Signal:   %s   cut: 25 range:25-321
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MERFSLRFVLMMVSIILTSSICQAQLSPTFYDQSCRNALSKIRSSVRTAIARERRMAASLIRMHFHDCFVHGCDASILLEGTSTIESERDALPNFKSVRGFEVIDKAKSEVEKVCPGIVSCADIIAVAARDASEYVGGPKWAVKVGRRDSTAAFKALANSGELPGFKDTLDQLSGLFSKKGLNTRDLVALSGAHTIGQSQCFLFRDRLYENSSDIDAGFASTRKRRCPTVGGDGNLAALDLVTPNSFDNNYYKNLMQKKGLLVTDQVLFGSGASTDGIVSEYSKNRSKFAADFATAMIKMGNIEPLTGSNGEIRKICSFVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, 3 introns). No EST.
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TAGTGAGTTT TCTTCATTTT TTCTAAAGAA TTATATAAAC GAATATATTA ATATTTCAAT TTGACCGGTA ATCTTAATCA ATATATAAAC ACACGTCATT TGGTGTGAAT TTCTAATGGA  GGACAGCTTT TAGTCTAATT AGATCATGTA AGACAGTTCC ATACATGCAC TGATCTAGTA ACATATTCGA ACATAGTTGA ATTGACCTTT TCATCAAAGG AAAATGAAAC TTACTAAACA  CATATATATA CTCACCCATA TGGGCAGACG ACCTAGTTTG AAGAAGAGCT AGATGAAAAT GACACCCCTA AAATAGGAAA GTAAATATAT ATAATTTTTT TTTGACAAAA ATGTTTGAAA  ACATATTTGG TTTAGTACGT ACGACCCCGT TAAGTATTAT GGTTTGGACT TCGAAATCTC CATTATGTTA TGCTTTGGTC ACGATATCAA AAAAAAATAT TATTATTATA ATAAATCTAG  GCCTGCCATC ATATGGATTA ATAGATATTA GCCAATTCAT ATGCATACAT GTATATATTA TGTACCATGA TACTTTTTCT TTTTTGGTTG ATATGCTACT ATTATATTTT TTTCGTAGTT  GAGCGGTGTC TACCCATAAA CATAACTGTT TCAAACTATT TGTAAATTGT AATCATAAAA CTTCGAAATT CTATAGGCGA GATGTTAGAA GATTTTGTTA AATATTATAG AAGAAATTCT  CTTAGCTAAT TTTTCCCTTT TTTCGAACTG TGGAACTATT TGAATGCTCA TCTAGTTGTA TATATGCTAA AAGATGGGGG TTTTCCAATC GTTCGAACAT AAATACATAA TGAATCACCA  CGTACTAAAA TCAACTAAGG AAACAAATGA AATTACAGGT ATTTTTGTGC GTAAATCATT TAAGAGATGA ATGATTCGAA TTTCGATTCT TAGGGAAAAA CACAACTACT ACCGTACTAC  GTATGAGATG CAAAACACTA CAAAAAAGGT TAAACACGAC TACGCACAAT AATGACTGTC CATAGCGATA TGCCGATACA TCGAAATTCC TAACAAATTT ATCATTATTA TAAATCAAAC  TACTGACGAA TCAAATTTGA GGAGTGGATT AATAAATAAC TTTTAATGTT ATCGGTGTTA GCCCGCAAAG ACTGGATTAT GCGATTTTTT TTTTAAAGGA AAGAAAAGCG ACAGTACATA  GCTAGCTTCA TATATGATCG CCATTGACCA TGCATTGTTT TCTTTCATAT ATATCTCTAA GAATTGTCAT CGTAATAGGG ACATTGCAAG TCCTCTAGTT ACTAAATAAT CACTCTTTTT  ATTTTTCACA ATATATAGCT CAATTCCAAT TTTATTTGCT AAAAAATACC ACATCGATAA AAATTTGTCC ACCAACCAAA TTCATAACGT GTTTCAAACG AATCATTCAC TCGTTCTGAG  ACCAATATAT ATAATTAGCT ACTAAATTAA ATTAAAAACT ATTTTTTGTT TGGTTAATGT GTTATATTTT GACTTTCTAA TTATATGTTC GTCAACTATT CCTTTCAAAC TAATCGCACA  AAATAATTGT TCGTTATATT CTTCAGATCC GAACTTCAAC CTGTATTATT ATAAGAATAA ACTATTTAAG CGCTTACTAA TGATGTTCTT GTTTTTCTTC TCAAACTTTT AGGTTATCTG  TTTTTATAAG TTAACAATTT GACAATTGAC CAAAATACAA AGTCAGAGCC CAACAATTAA TTTATTTTAA TCCAAATATT CTCTAGCTAA CATATGATAG ATCTAACATA TTTTAAATTA  CAGTCTCCAA CCTTGAACAG CGACACCGCG TGAAAACTCT CATGCACGTA TATTATATAA ACCCCTAGGG TTTGTAACAT TCAACATCAA TCTCAAATAA TTCATCAACG AGAAAAGATT 
AATTCTTACT ACCAAAAGAA AGAAGATAAA TTACTATTTT GTTTTACGTA CGAAATATAT ACCAAGTGAG ATCTACAAAT 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TACATGCATG CGATAATGCA TTTTATATTG TTTGTTAAAT TTATTCGTTG ATCTCTTTGT TGTAATGTTT TGTGATTCTT ACTACCAAAT TGTGTATTAT TTGTTTTTAA TATTTGAATA  AATGCCAATT AGTTTTATGA TTATATAGTC ATATTTTTTG ATAATTCAAT CCAAGTTACA ATTGCTGGTT CAATGTGGTT TGGGCTAAAC CAACCACCGA ATCTGTATGG TTTTATTTTT  AGAGTTCCAC CATATATTGG GTGCACCATG CCACATGGAA TTCTTACCTA AAAAGGTATC TCTGTTTCTT CAAGCCTGTG AAAATGCGCG ACCAATGAGT AAACAGAGCA TGTGACCGAA  TTTTCGAATC GAGAAAACCA TCGTCTTCCT TATTTCTACG TATTTTACGG CGAGCCTCTA GTCGCTCATC GTCAGCCCCA TAAATTTCCT GAATCTTCTC CGATAACTTC GTCTTATATA  CATCGCCACA GAAATTTCGG TTCCTGTTCG TGAATTAGCG GTAGGGTTTC ATTTGTATCT CCGCAACGAA TTTTCCTATT GATTGGTTCG TTTGGATCTG AGAGGTATTG ATTTCGATCG  ATCTCAAAAG GGTAGTTGTT CGTTTGCTCA ATCGAACGAG ATTGTTATTG TTTTCTGCTG TGGAATAGTA TCTGGATCTG TCAGATTAAT AGGCTAGTTT TTACGATTGA GCTATCGGAA  ATGATTTGAT CTTCATGTGT GGTTGATCAT CGAAGAGTGT TTCATTGAGA CTGTTAATGA ATATTGCTGT AAGAGAGGAG GAGGAGAATC TGCTTTTAAG CTTCTCGTCG TACTCGTTTC  TGGGATTTCT CAGGTTCTCA AGTTTGGATT TCAATAAGAA ATCTGCGTCC ACCGTAAACC CTAGATTTAG ATGGGATAAG GTGTTCTTTC AGATAAAAGG TGAGAACTTT CCGAATTTAA 
CTTAGTTGAA CTGAGATGGG TTCGTCACAA GGCTCCACAC 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGAGATTTTCACTAAGGTTTGTGCTAATGATGGTGAGCATCATCCTCACGTCATCGATTTGTCAAGCACAACTTTCTCCAACATTCTACGATCAATCGTGTCGGAATGCTCTTTCG
AAGATCAGATCCTCCGTTAGAACGGCCATCGCTCGTGAGAGAAGAATGGCCGCGTCTCTAATCCGCATGCACTTCCATGACTGTTTTGTTCAT
GTAAGTTTTTATTCTTCTAAATACTAA
TTCCACATTTTTAAAAAACCTTACCCAATCATTTAATAATAGTTTTGTGTATGTTTAGGGGTGTGACGCGTCGATATTGCTCGAGGGAACATCAACGATAGAGAGTGAACGAGATGCATT
GCCAAACTTCAAATCAGTAAGAGGTTTTGAAGTCATAGATAAAGCCAAATCCGAAGTCGAGAAAGTTTGTCCCGGCATTGTTTCTTGCGCTGATATCATAGCGGTTGCGGCAAGAGACGC
TTCTGAATAC
GTATGTTTGTGATTATATATGAATATACCCAATATCCTTTATATATATAAACCATGCATATGTATAACAACTCTCCAACCAATACTTAGGTGGGAGGTCCAAAATGGGCA
GTGAAAGTCGGAAGACGAGATTCGACAGCTGCGTTCAAGGCTCTAGCAAATAGTGGTGAACTCCCGGGATTTAAAGATACCCTTGATCAACTCTCAGGTCTTTTCAGCAAGAAAGGTCTT
AACACAAGAGACCTTGTTGCTCTTTCAG
GTAGGTCCAAGAATCATATTTGTATATACATTAAGTTTTTTTTTTGATGACTCCTTAAATGTGTGAATAGCTATGCTAATTGCATCACTAGT
AATAACAATGTACTAGACAAATTTATAATTTCTAATTTATATTCTTTGTCACGATAACTATTCAGGAGCACACACCATAGGACAATCTCAATGCTTCTTGTTCCGGGACAGGCTTTACGA
GAACTCAAGCGACATCGACGCAGGATTTGCCAGCACACGCAAACGTCGATGCCCAACCGTGGGAGGTGATGGTAATCTGGCAGCATTGGATCTAGTAACACCTAATTCTTTCGACAACAA
TTACTACAAAAACTTAATGCAAAAGAAAGGACTATTAGTAACCGATCAAGTTTTGTTCGGGTCCGGTGCATCAACTGACGGCATTGTGTCGGAATATAGCAAGAACCGGTCAAAATTCGC
GGCAGATTTCGCAACAGCCATGATCAAGATGGGTAATATAGAACCTCTCACTGGCTCTAATGGAGAAATCAGAAAGATATGCAGCTTTGTTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGAGATTTTCACTAAGGTTTGTGCTAATGATGGTGAGCATCATCCTCACGTCATCGATTTGTCAAGCACAACTTTCTCCAACATTCTACGATCAATCGTGTCGGAATGCTCTTTCG
AAGATCAGATCCTCCGTTAGAACGGCCATCGCTCGTGAGAGAAGAATGGCCGCGTCTCTAATCCGCATGCACTTCCATGACTGTTTTGTTCAT
GGGTGTGACGCGTCGATATTGCTCGAG
GGAACATCAACGATAGAGAGTGAACGAGATGCATTGCCAAACTTCAAATCAGTAAGAGGTTTTGAAGTCATAGATAAAGCCAAATCCGAAGTCGAGAAAGTTTGTCCCGGCATTGTTTCT
TGCGCTGATATCATAGCGGTTGCGGCAAGAGACGCTTCTGAATAC
GTGGGAGGTCCAAAATGGGCAGTGAAAGTCGGAAGACGAGATTCGACAGCTGCGTTCAAGGCTCTAGCAAATAGT
GGTGAACTCCCGGGATTTAAAGATACCCTTGATCAACTCTCAGGTCTTTTCAGCAAGAAAGGTCTTAACACAAGAGACCTTGTTGCTCTTTCAG
GAGCACACACCATAGGACAATCTCAA
TGCTTCTTGTTCCGGGACAGGCTTTACGAGAACTCAAGCGACATCGACGCAGGATTTGCCAGCACACGCAAACGTCGATGCCCAACCGTGGGAGGTGATGGTAATCTGGCAGCATTGGAT
CTAGTAACACCTAATTCTTTCGACAACAATTACTACAAAAACTTAATGCAAAAGAAAGGACTATTAGTAACCGATCAAGTTTTGTTCGGGTCCGGTGCATCAACTGACGGCATTGTGTCG
GAATATAGCAAGAACCGGTCAAAATTCGCGGCAGATTTCGCAACAGCCATGATCAAGATGGGTAATATAGAACCTCTCACTGGCTCTAATGGAGAAATCAGAAAGATATGCAGCTTTGTT
AATTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGAGAT TTTCACTAAG GTTTGTGCTA ATGATGGTGA GCATCATCCT CACGTCATCG ATTTGTCAAG CACAACTTTC TCCAACATTC TACGATCAAT CGTGTCGGAA TGCTCTTTCG  AAGATCAGAT CCTCCGTTAG AACGGCCATC GCTCGTGAGA GAAGAATGGC CGCGTCTCTA ATCCGCATGC ACTTCCATGA CTGTTTTGTT CATGGGTGTG ACGCGTCGAT ATTGCTCGAG  GGAACATCAA CGATAGAGAG TGAACGAGAT GCATTGCCAA ACTTCAAATC AGTAAGAGGT TTTGAAGTCA TAGATAAAGC CAAATCCGAA GTCGAGAAAG TTTGTCCCGG CATTGTTTCT  TGCGCTGATA TCATAGCGGT TGCGGCAAGA GACGCTTCTG AATACGTGGG AGGTCCAAAA TGGGCAGTGA AAGTCGGAAG ACGAGATTCG ACAGCTGCGT TCAAGGCTCT AGCAAATAGT  GGTGAACTCC CGGGATTTAA AGATACCCTT GATCAACTCT CAGGTCTTTT CAGCAAGAAA GGTCTTAACA CAAGAGACCT TGTTGCTCTT TCAGGAGCAC ACACCATAGG ACAATCTCAA  TGCTTCTTGT TCCGGGACAG GCTTTACGAG AACTCAAGCG ACATCGACGC AGGATTTGCC AGCACACGCA AACGTCGATG CCCAACCGTG GGAGGTGATG GTAATCTGGC AGCATTGGAT  CTAGTAACAC CTAATTCTTT CGACAACAAT TACTACAAAA ACTTAATGCA AAAGAAAGGA CTATTAGTAA CCGATCAAGT TTTGTTCGGG TCCGGTGCAT CAACTGACGG CATTGTGTCG  GAATATAGCA AGAACCGGTC AAAATTCGCG GCAGATTTCG CAACAGCCAT GATCAAGATG GGTAATATAG AACCTCTCAC TGGCTCTAAT GGAGAAATCA GAAAGATATG CAGCTTTGTT 
AATTAA 

Retrieve as FASTA