Entry information : SbPrx113 (Sobic.009G033400.1 [2.1] / SB09G002820 [1.4])
Entry ID 810
Creation 2005-12-16 (Christophe Dunand)
Last sequence changes 2011-01-18 (Toky Ramarohetra (Scipio))
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbPrx113 (Sobic.009G033400.1 [2.1] / SB09G002820 [1.4])
Name (synonym) SbPrx113 (Sobic.009G033400.1 [2.1] / SB09G002820 [1.4])
Class Class III peroxidase    [Orthogroup: Prx153]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx113
start..stop
S start..stop
ZmPrx77 577 0 1..338 1..336
SiPrx93 563 0 1..338 1..334
OsPrx69 499 6e-180 1..338 1..332
BdiPrx78 456 1e-162 37..338 44..342
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3059203..3059451 249 N° 2 3058309..3059076 768  
complement(join(3058309..3059076,3059203..3059451))


exon

Literature and cross-references SbPrx113 (Sobic.009G033400.1 [2.1] / SB09G002820 [1.4])
Literature Cordonnier-Pratt,M.-M. et al., unpublished
DNA ref. Phytozome 12:   chromosome_9 (3059451..3058309)
Protein sequence: SbPrx113 (Sobic.009G033400.1 [2.1] / SB09G002820 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   338
PWM (Da):   %s   35924.4  
PI (pH):   %s   8.97
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSAGTRADEVVVQVRQLVVVVAVAVMATSCFSSSEAQLQVGYYNATCPAAESLIETIVHAAVRKDAGNGPGLIRLFFHDCFVRGCDASVLLDDPTGTPGNRTVEKTSQPNFPSLRGFSVINRAKRVVERRCPGTVSCADIVAFAARDAARIMGGIRFAMPSGRLDGRVSNASEATANLPPASFNLTQLLARFASKNLTADDLVTLSGAHSIGRSHCSSFANTRLYPQLDATLNVTLAARLRAKCPAAPGGKDRVVDLDFRTPLQLDNQYYSNVATHEVVFGSDQALGDRNDTAALVALYAANRKIWSQKFAAAMVKMGSIEVLTGPPGEVRLKCNKVN*

Retrieve as FASTA  
Remarks Complete sequence from 15 EST and Genomic (chromo 9, intron 1).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCGCCGGCACCAGAGCTGATGAGGTCGTCGTCCAAGTACGGCAGCTCGTCGTCGTAGTGGCTGTCGCCGTGATGGCGACATCATGCTTCTCCTCCTCGGAGGCGCAGCTCCAGGTC
GGGTACTACAACGCCACCTGCCCCGCCGCCGAGAGCCTCATCGAGACCATCGTCCACGCCGCCGTCCGTAAGGACGCCGGCAACGGCCCCGGCCTCATCCGCCTCTTCTTCCACGACTGC
TTCGTCAGG
GTACGTTTACGTACGCGCACACACACAATGCCGCCGCCGCCGCCGCCGCCGCCGTGCTGCTCCTGCCACTGCCACTGCCATTGCCGGAACGGCAATACACTAAACTAAACA
ACATCTCCATTGCAGGGATGCGACGCGTCGGTGCTGCTAGACGACCCGACGGGCACGCCAGGGAACAGGACGGTGGAGAAGACGTCGCAACCAAACTTCCCCAGCCTCCGTGGGTTCAGC
GTCATCAACCGGGCGAAACGCGTGGTGGAGCGGCGGTGCCCGGGGACAGTCTCGTGCGCCGACATCGTCGCCTTCGCGGCGCGCGACGCCGCCCGGATCATGGGCGGGATCCGCTTCGCC
ATGCCTTCCGGCCGCCTCGACGGGCGCGTCTCCAACGCGTCCGAGGCGACGGCCAACCTTCCGCCGGCGTCGTTCAACCTGACGCAGCTCCTGGCCCGGTTCGCGTCCAAGAACCTCACC
GCCGACGACCTCGTCACGCTGTCGGGCGCCCACTCCATCGGCCGCTCCCACTGCTCCTCCTTCGCCAACACGCGGCTGTACCCGCAGCTGGACGCCACGCTGAACGTCACGCTGGCGGCG
AGGCTCAGGGCCAAGTGCCCCGCCGCTCCCGGCGGGAAAGACCGCGTCGTCGACCTCGATTTCAGGACGCCGCTGCAGCTGGACAACCAGTACTACAGCAACGTGGCGACGCATGAGGTG
GTGTTCGGGTCGGACCAGGCGCTCGGCGACCGGAACGACACGGCGGCGCTCGTCGCGCTGTATGCTGCCAACCGTAAGATATGGTCGCAGAAGTTCGCGGCGGCCATGGTGAAGATGGGT
AGCATCGAGGTGCTCACCGGCCCCCCCGGCGAGGTCAGGCTCAAGTGCAACAAGGTCAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCGCCGGCACCAGAGCTGATGAGGTCGTCGTCCAAGTACGGCAGCTCGTCGTCGTAGTGGCTGTCGCCGTGATGGCGACATCATGCTTCTCCTCCTCGGAGGCGCAGCTCCAGGTC
GGGTACTACAACGCCACCTGCCCCGCCGCCGAGAGCCTCATCGAGACCATCGTCCACGCCGCCGTCCGTAAGGACGCCGGCAACGGCCCCGGCCTCATCCGCCTCTTCTTCCACGACTGC
TTCGTCAGG
GGATGCGACGCGTCGGTGCTGCTAGACGACCCGACGGGCACGCCAGGGAACAGGACGGTGGAGAAGACGTCGCAACCAAACTTCCCCAGCCTCCGTGGGTTCAGCGTCATC
AACCGGGCGAAACGCGTGGTGGAGCGGCGGTGCCCGGGGACAGTCTCGTGCGCCGACATCGTCGCCTTCGCGGCGCGCGACGCCGCCCGGATCATGGGCGGGATCCGCTTCGCCATGCCT
TCCGGCCGCCTCGACGGGCGCGTCTCCAACGCGTCCGAGGCGACGGCCAACCTTCCGCCGGCGTCGTTCAACCTGACGCAGCTCCTGGCCCGGTTCGCGTCCAAGAACCTCACCGCCGAC
GACCTCGTCACGCTGTCGGGCGCCCACTCCATCGGCCGCTCCCACTGCTCCTCCTTCGCCAACACGCGGCTGTACCCGCAGCTGGACGCCACGCTGAACGTCACGCTGGCGGCGAGGCTC
AGGGCCAAGTGCCCCGCCGCTCCCGGCGGGAAAGACCGCGTCGTCGACCTCGATTTCAGGACGCCGCTGCAGCTGGACAACCAGTACTACAGCAACGTGGCGACGCATGAGGTGGTGTTC
GGGTCGGACCAGGCGCTCGGCGACCGGAACGACACGGCGGCGCTCGTCGCGCTGTATGCTGCCAACCGTAAGATATGGTCGCAGAAGTTCGCGGCGGCCATGGTGAAGATGGGTAGCATC
GAGGTGCTCACCGGCCCCCCCGGCGAGGTCAGGCTCAAGTGCAACAAGGTCAACTGA

Retrieve as FASTA