Entry information : EgrPrx51 (Eucgr.A02457 / Egrandis_v1_0.018800m)
Entry ID 8100
Creation 2011-02-04 (Christophe Dunand)
Last sequence changes 2011-02-07 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-10-30 (Qiang Li)
Peroxidase information: EgrPrx51 (Eucgr.A02457 / Egrandis_v1_0.018800m)
Name (synonym) EgrPrx51 (Eucgr.A02457 / Egrandis_v1_0.018800m)
Class Class III peroxidase    [Orthogroup: Prx057]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx51
start..stop
S start..stop
EcamPrx51 675 0 1..334 1..334
EglPrx51 648 0 1..334 1..333
EguPrx51 622 0 1..334 1..334
EgrPrx53 622 0 1..334 1..334
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 35229578..35229805 228 N° 2 35229938..35230129 192 N° 3 35230256..35230421 166 N° 4 35231904..35232322 419
join(35229578..35229805,35229938..35230129,35230256..35230421,35231904..35232322 )


exon

Literature and cross-references EgrPrx51 (Eucgr.A02457 / Egrandis_v1_0.018800m)
DNA ref. Phytozome 12:   scaffold_1 (35229578..35232322)
Protein sequence: EgrPrx51 (Eucgr.A02457 / Egrandis_v1_0.018800m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   335 (305)
PWM (Da):   %s   35743.85 (32645.1) Transmb domain:   %s   i7-29o
PI (pH):   %s   5.94 (5.58) Peptide Signal:   %s   cut: 30 range:30-334
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARSSTLSSPTVVALFAAALLFLLRPLNAELTADFYAKTCPDVSSIVQTVIHEALESDPRITASLLRLHFHDCFVQGCDGSILLDNSPTIKSEKDSAPSFKSARGFGVVDKIKAAIESTCPGTVSCADILALAANASVYLSGGPYWTVLLGRRDGLTANQGLANTSIPSPFDSYANLTSKFFAVGLDITDLVTLSGAHTFGRAHCKSFTPRLYNFTADGGPDPTLSPWYLTALQKLCPPNFSSSVLADLDPTTPNLFDNHYYSNLQKNDGLFQSDQELYSTAGAATVPIVNSFSADQSAFFKSFTRSIVNMGNISPLTGSNGEIRCNCRKVNES*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from phytozome. PS is missing.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCCGTTCTTCTACTCTTTCGTCGCCAACGGTGGTGGCCCTTTTTGCCGCCGCATTGTTGTTTCTCCTCCGTCCATTGAATGCTGAACTAACTGCTGATTTTTATGCAAAGACATGC
CCGGACGTGTCCAGCATCGTCCAGACCGTGATTCATGAGGCCCTTGAATCCGACCCACGCATCACCGCCAGCCTCCTCCGTCTCCATTTCCACGATTGCTTCGTCCAA
GTGAGTCCCTAC
AATGGATCAATTCCCATTGACAATGAGTCCCAACTTACCGCATTCTTTTTACGGTACTTTTGATCTGATTATTGAGTTATTAGCCACGTAACCTAATGCTTGAGAATGACATGTTTAAAG

GGGTGTGATGGATCGATATTGCTGGACAATAGCCCAACCATAAAGAGCGAGAAAGATTCCGCTCCGAGTTTTAAGTCCGCAAGAGGGTTCGGTGTGGTGGACAAGATCAAAGCGGCTATT
GAGAGCACTTGTCCTGGGACTGTGTCTTGCGCTGACATCCTCGCCTTGGCTGCTAACGCTTCCGTTTATTTG
GTATATGTTGTTTTAGTCAAAGAAATATAAAACATATTTAAAGTATAC
TTAGGATTCGTTATTGTTACTTGGCCTACACGAATTACAATTGTGTTTCTCTTGATTATCACTTCTATGAAATTGCAGTCAGGAGGTCCATATTGGACGGTGCTCTTGGGGAGGAGAGAC
GGCTTGACCGCGAACCAAGGGCTAGCGAACACATCGATACCCTCCCCTTTTGATAGCTATGCCAACCTCACTTCCAAGTTCTTTGCTGTGGGCTTGGACATCACCGACCTTGTCACACTT
TCCG
GTAAAATAGAACAGTTGGACTTGCATTTTGATACGAAACGGGCAACTGCAGATATTTATGCACACAATAGATTAACAGAGTGAAATGTTAGGTTTTTGTCACATAACTTATCAGCA
CAAACATCGCGTCACTTTCATTTAGCACATTTCAACTTCCTAATATGATCAAGGTCTCTTCTTCATTGAGATCAACTGACGGGCATTGGTTGTGCATGTGCATGGGCCGTGCCCGCACAG
CTCATGCCCCGGCAATGCTATCTACTAGAATGAATTTTAGTTAAGGATTAAGGTTTACTTTATTTATCTAAAATTGAATAAGTAAAGAATTGTCCTAAAACATGAGATCGACTAAAGTGC
ATGTGTTGTGCCTAGGCTGTTCATGGGTCATGCATGGGCTATGCACATTTACTAGAAGGAGTTTTGGCTGAGGATTAATGATTTCTTTTTTACCAAAAATTGAAAAAGTAAAGGATTGCC
CTTGACTTGAGATCGACTGACGTGCATTCGTTGTGCCTGGGCCATGCCATGTTGTGCATGGGTATGTAAATATATTAGAAGGAATTTTGGCTAAAGAATTAAGGGTTTCTTTTCAATCTA
AAATTGAATAAGTAAAGGATTGCCCTCGACTTAATTTCAGGAGCAGTTGTGTATCATCACTACTCTAAAAAAGATAGATTATTTAAAAACAATTTTTTGCATGACCGAGACTTATCTCCT
CGGTAAATTCAAAAATGAGAGGAAGCCGATGATACGTAATTTCTTTAAATTAGAAATTATGGGTTCATACATTTGCAGGTACATAATTTGCTAGTCCTAGATAGAAATGGTAATTCATAT
AGGGTTAGTTTGATTGAACTGAATAAGTGAAGTTAAAATCCCCTTGCGTGGATCCCACTTATCTTTAATTCAAATGGATCTAAACCAAGCCCGTATTAGCAACTCTTAGGTCTTATCTAG
TATAACTTCTGATATCAAGATGAAGAAGTGGTCAACAATGACACTTCATCGTTCAATTCATGACGAGGTTCATAGCGCTGAAACCATCGAATTAATGTAATATTTTCTTTGTTGTGATTT
GTTTTCAATCAAACTAGTGTACTTTTATGTGTAACTTTTTTTTATTACAAATTTGAAAAATATATTCATGTTTTATTCATTTTTTCAATGGGTAATTTTATATTCCTGATATCATTACAG
GAGTATAAATATCGGGGGAGGATGCTATCAAAATTTGCAAGCCCCTCATATACTTGTATGAGAAATGCCAAGTATACTGGGGTCATTTGATAGAATCAATAAATTAAGTGATGTCACAGA
TCATTATTATTTATTTATATTTTTACTAATGAGTTTGTTGCTTATGTTTAGTATACAAATTCTATTAAGCATTCCTAGTATTGGTCTATTTATCCACCTTCACAATTGAGCATCTGCAGA
TATTTTGTTCTCTTAGCTAATTATTCGTGCATATGATAATAAACAGGAGCTCACACCTTTGGACGTGCACATTGCAAGTCATTCACCCCTAGGCTGTACAACTTCACCGCAGATGGTGGC
CCCGATCCCACCCTAAGCCCGTGGTACTTGACGGCTCTCCAGAAACTTTGCCCTCCAAACTTCAGTAGTAGCGTCCTTGCCGACCTCGACCCGACGACCCCGAACTTGTTTGACAACCAC
TACTACTCCAACCTCCAGAAAAATGACGGGCTTTTTCAGTCTGATCAAGAGCTGTACTCGACAGCCGGTGCTGCGACAGTACCCATCGTCAACAGCTTCAGTGCCGACCAGAGTGCCTTC
TTCAAGAGCTTCACTCGGTCGATAGTAAACATGGGAAACATCAGTCCTCTCACCGGAAGTAACGGGGAGATCAGGTGCAATTGTAGGAAGGTCAATGAGAGTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCCGTTCTTCTACTCTTTCGTCGCCAACGGTGGTGGCCCTTTTTGCCGCCGCATTGTTGTTTCTCCTCCGTCCATTGAATGCTGAACTAACTGCTGATTTTTATGCAAAGACATGC
CCGGACGTGTCCAGCATCGTCCAGACCGTGATTCATGAGGCCCTTGAATCCGACCCACGCATCACCGCCAGCCTCCTCCGTCTCCATTTCCACGATTGCTTCGTCCAA
GGGTGTGATGGA
TCGATATTGCTGGACAATAGCCCAACCATAAAGAGCGAGAAAGATTCCGCTCCGAGTTTTAAGTCCGCAAGAGGGTTCGGTGTGGTGGACAAGATCAAAGCGGCTATTGAGAGCACTTGT
CCTGGGACTGTGTCTTGCGCTGACATCCTCGCCTTGGCTGCTAACGCTTCCGTTTATTTG
TCAGGAGGTCCATATTGGACGGTGCTCTTGGGGAGGAGAGACGGCTTGACCGCGAACCAA
GGGCTAGCGAACACATCGATACCCTCCCCTTTTGATAGCTATGCCAACCTCACTTCCAAGTTCTTTGCTGTGGGCTTGGACATCACCGACCTTGTCACACTTTCCG
GAGCTCACACCTTT
GGACGTGCACATTGCAAGTCATTCACCCCTAGGCTGTACAACTTCACCGCAGATGGTGGCCCCGATCCCACCCTAAGCCCGTGGTACTTGACGGCTCTCCAGAAACTTTGCCCTCCAAAC
TTCAGTAGTAGCGTCCTTGCCGACCTCGACCCGACGACCCCGAACTTGTTTGACAACCACTACTACTCCAACCTCCAGAAAAATGACGGGCTTTTTCAGTCTGATCAAGAGCTGTACTCG
ACAGCCGGTGCTGCGACAGTACCCATCGTCAACAGCTTCAGTGCCGACCAGAGTGCCTTCTTCAAGAGCTTCACTCGGTCGATAGTAAACATGGGAAACATCAGTCCTCTCACCGGAAGT
AACGGGGAGATCAGGTGCAATTGTAGGAAGGTCAATGAGAGTTGA

Retrieve as FASTA