Entry information : EgrPrx52 (Eucgr.A02458 / Egrandis_v1_0.038094m)
Entry ID 8104
Creation 2011-02-04 (Christophe Dunand)
Last sequence changes 2011-02-07 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-10-30 (Qiang Li)
Peroxidase information: EgrPrx52 (Eucgr.A02458 / Egrandis_v1_0.038094m)
Name (synonym) EgrPrx52 (Eucgr.A02458 / Egrandis_v1_0.038094m)
Class Class III peroxidase    [Orthogroup: Prx057]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx52
start..stop
S start..stop
EgrPrx50 676 0 1..333 1..333
EglPrx52 676 0 1..333 1..333
EcamPrx50 671 0 1..333 1..333
EguPrx50 607 0 1..333 1..333
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 35235175..35235399 225 N° 2 35235508..35235699 192 N° 3 35235827..35235992 166 N° 4 35236694..35237112 419
join(35235175..35235399,35235508..35235699,35235827..35235992,35236694..35237112 )


exon

Literature and cross-references EgrPrx52 (Eucgr.A02458 / Egrandis_v1_0.038094m)
DNA ref. Phytozome 12:   scaffold_1 (35235175..35237112)
Protein sequence: EgrPrx52 (Eucgr.A02458 / Egrandis_v1_0.038094m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   334 (305)
PWM (Da):   %s   35567.69 (32739.2)  
PI (pH):   %s   5.05 (5.05) Peptide Signal:   %s   cut: 29 range:29-333
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAGSSTPSSLTAVTLLAALLLFLNPSNAQLTANFYAKTCPSVSSIVQTVIQEALQSDPRITASLLRLHFHDCFVDGCDGSLLLDNSPTIKSEKDAAPNFKSARGFDVVDKIKAAIESACPGTVSCADILALAAQASVSLSEGPYWTVLLGRRDSLTANQAGANTSIPSPSDSYNNLVSKFSAVGLDITDLATLSGAHTFGRAQCKSFNPRLYNFTANGGPDPTINPWYLTNLRKLCPQNGDSSVLADLDPTTPNLFDNHYYSNLQKNEGLLLSDQELYSTTGAATISIVNSFSFDQSAFFESFARSIVNMGNISPLTGSNGEIRFNCRKVNWS*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction from phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGGTTCTTCTACTCCTTCCTCGCTGACGGCGGTGACCCTTCTCGCCGCATTGTTGTTGTTCCTCAATCCATCGAACGCTCAGCTGACTGCCAATTTTTATGCGAAGACATGCCCG
AGCGTGTCCAGTATTGTCCAAACCGTGATCCAGGAGGCCCTTCAATCTGACCCACGCATCACTGCCAGCCTCCTCCGTCTCCATTTCCACGATTGTTTCGTCGAC
GTGAGTCCCTAAGCT
AGATCAATTCCCATTAACAATGGTGCTCTCAATCTGATTACCAAGTAGCTAGTCACGCAACCTAATGTTTAAGCCTGACATGTGTGTTAAAAGGGGTGTGATGGATCGCTGCTGCTGGAC
AATAGCCCAACCATAAAGAGCGAGAAAGATGCAGCTCCGAATTTTAAGTCCGCAAGAGGGTTTGATGTCGTGGACAAGATCAAAGCGGCTATTGAGAGTGCTTGTCCAGGGACCGTGTCT
TGCGCCGACATTCTTGCCCTTGCTGCTCAAGCTTCCGTCTCTTTG
GTATATGTAGTTATAGTCAAAGAAACATAAACATAAATCTAAAGTATATTCAGGGTTCATTATTATAACTCACCC
TACTCAAATCATTATTGTATTTCTCTTGATTATCGCTCTTACCAAATTGCAGTCAGAAGGTCCATATTGGACAGTGCTCTTGGGGAGGAGGGACAGCTTGACCGCGAACCAAGCCGGAGC
GAACACATCGATACCCTCCCCTTCTGATAGCTATAACAACCTCGTTTCCAAATTCTCTGCTGTTGGCTTGGACATCACCGACCTTGCTACACTTTCCG
GTAAAAAAGAACAGTTGGACTT
GCATTTTAATACGAAACGTGCAACCGTAGATATTGATGCACAAAAAAGATTTATAGAGTGAGATGCTGGATTTTTGTCACATAATTTATCGGCACAAACATCTCTTCACTTTTGTTTAAC
ACATTCTAACTTCCTAATATGATCATAGTCTAAGATTAATTGTAATCTATTGACATGCCTGTCTGGTATATGGCCTATGCATGCCTCGTGCATAGGCCATGCACATCTCCCAGAAGGAAT
TTTGGCTAAGGATTATTAATCTATAATTGAATAAGTAATTTTCCCTTGACTTGAGATCGATCCACATGCATGTGTTATGCCTAGGCCATGCTTGTATCGTGCATGGGCTGTGCACATCTA
CTAGAACGAATTTTGGCTAAGGATTAAGGATTTCTTTTTCATCACAGGAGTATGAATATCGGGAAAGATGGTATCAAAATTTGCAAGCCCCTCATGTACTTATCTAAGAAATGATAAGTT
TACAGAATCAATATATTAAGTGATGTCGCGGATCATTATTACTTATTCATCTATCCACTAATGAGTTTGCTGCATATGTTTGGCATACAAATTCCGTTGAGCATTCCTAGCATTGATCTA
TTCATCCATCTCCATAATTAAGCATCTGCAGATATTTTGTTCTCTTAGCTAACTTTTCGTGCATACGACAATAAAACAGGAGCTCACACCTTCGGACGTGCACAGTGCAAGTCATTCAAC
CCTAGGCTCTACAACTTCACCGCGAACGGTGGCCCTGATCCCACCATAAACCCGTGGTACTTGACCAATCTCCGGAAACTTTGCCCTCAGAATGGCGACAGTAGTGTCCTCGCCGACCTC
GACCCGACAACCCCAAACTTGTTTGACAACCACTACTACTCCAACCTCCAGAAAAATGAAGGGCTTCTTCTGTCCGATCAAGAGCTGTACTCCACAACTGGCGCCGCAACAATTTCCATC
GTCAACAGCTTTAGCTTTGACCAGAGTGCCTTCTTCGAGAGCTTCGCTCGGTCGATAGTAAACATGGGAAATATTAGTCCTCTCACCGGAAGTAACGGGGAGATCCGGTTCAATTGTAGG
AAGGTCAATTGGAGTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGGTTCTTCTACTCCTTCCTCGCTGACGGCGGTGACCCTTCTCGCCGCATTGTTGTTGTTCCTCAATCCATCGAACGCTCAGCTGACTGCCAATTTTTATGCGAAGACATGCCCG
AGCGTGTCCAGTATTGTCCAAACCGTGATCCAGGAGGCCCTTCAATCTGACCCACGCATCACTGCCAGCCTCCTCCGTCTCCATTTCCACGATTGTTTCGTCGAC
GGGTGTGATGGATCG
CTGCTGCTGGACAATAGCCCAACCATAAAGAGCGAGAAAGATGCAGCTCCGAATTTTAAGTCCGCAAGAGGGTTTGATGTCGTGGACAAGATCAAAGCGGCTATTGAGAGTGCTTGTCCA
GGGACCGTGTCTTGCGCCGACATTCTTGCCCTTGCTGCTCAAGCTTCCGTCTCTTTG
TCAGAAGGTCCATATTGGACAGTGCTCTTGGGGAGGAGGGACAGCTTGACCGCGAACCAAGCC
GGAGCGAACACATCGATACCCTCCCCTTCTGATAGCTATAACAACCTCGTTTCCAAATTCTCTGCTGTTGGCTTGGACATCACCGACCTTGCTACACTTTCCG
GAGCTCACACCTTCGGA
CGTGCACAGTGCAAGTCATTCAACCCTAGGCTCTACAACTTCACCGCGAACGGTGGCCCTGATCCCACCATAAACCCGTGGTACTTGACCAATCTCCGGAAACTTTGCCCTCAGAATGGC
GACAGTAGTGTCCTCGCCGACCTCGACCCGACAACCCCAAACTTGTTTGACAACCACTACTACTCCAACCTCCAGAAAAATGAAGGGCTTCTTCTGTCCGATCAAGAGCTGTACTCCACA
ACTGGCGCCGCAACAATTTCCATCGTCAACAGCTTTAGCTTTGACCAGAGTGCCTTCTTCGAGAGCTTCGCTCGGTCGATAGTAAACATGGGAAATATTAGTCCTCTCACCGGAAGTAAC
GGGGAGATCCGGTTCAATTGTAGGAAGGTCAATTGGAGTTGA

Retrieve as FASTA