Entry information : EgrPrx56 (Eucgr.A02844 / Egrandis_v1_0.019519m)
Entry ID 8107
Creation 2011-02-04 (Christophe Dunand)
Last sequence changes 2011-02-07 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-10-30 (Qiang Li)
Peroxidase information: EgrPrx56 (Eucgr.A02844 / Egrandis_v1_0.019519m)
Name (synonym) EgrPrx56 (Eucgr.A02844 / Egrandis_v1_0.019519m)
Class Class III peroxidase    [Orthogroup: Prx036]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx56
start..stop
S start..stop
EglPrx56 664 0 1..323 1..323
EcamPrx56 656 0 1..320 1..320
EguPrx56 642 0 1..323 1..323
EgrPrx102 597 0 1..323 1..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 38848759..38848977 219 N° 2 38849063..38849251 189 N° 3 38849789..38850352 564  
join(38848759..38848977,38849063..38849251,38849789..38850352)


exon

Literature and cross-references EgrPrx56 (Eucgr.A02844 / Egrandis_v1_0.019519m)
DNA ref. Phytozome 12:   scaffold_1 (38848759..38850352)
Protein sequence: EgrPrx56 (Eucgr.A02844 / Egrandis_v1_0.019519m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   324 (297)
PWM (Da):   %s   35581.03 (32673.3)  
PI (pH):   %s   8.4 (7.47) Peptide Signal:   %s   cut: 27 range:27-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAVLALKPRSRVIFALLLAMVSVSRATLDAHYYDQTCPQAEKIILQTVQNATRHDPKVPARLLRMFFHDCFIRGCDASLLLDSTPGNQAEKDGPPNISVRAFYVIDDAKAKLEMACPHTVSCADIIAIAARDVVTMAGGPSWNVLKGRKDGRVSNASETINLPAPTFNVTQLLQSFAERGLGLKDLVALSGGHTLGFSHCSSFDARLRNFSSTHDIDPTLNHAFAQLLKNECPKPNRNRNAGQFLDATSSTFDNDYYRRLVAGEGVFGSDQALYSDYRTRWIVNLFAQDQSLFFSEFAASMVRLGNVGVRENGEVRIKCRAVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction from phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGTCCTTGCGCTGAAGCCTCGCTCTCGCGTGATTTTCGCCCTTCTACTGGCGATGGTTTCGGTATCGAGAGCCACACTCGATGCCCATTATTATGACCAGACATGTCCACAAGCT
GAGAAAATCATATTGCAGACGGTTCAAAATGCCACAAGGCACGACCCCAAAGTCCCCGCTCGTCTCCTAAGGATGTTCTTCCACGACTGTTTCATTCGG
GTATGGACATCTACATTCTTA
CATGCAAAATCTCTCTCTCTCTCTCTCTCTCTCTCTCATGTCATTGGATGGTGCGTACCCACAGGGATGCGATGCGTCGTTGTTGCTCGACTCAACTCCTGGAAACCAAGCAGAGAAAGA
TGGTCCTCCAAATATCTCGGTTCGAGCATTCTACGTGATCGATGATGCCAAAGCAAAGCTCGAAATGGCATGTCCACATACAGTCTCTTGTGCTGATATCATCGCCATTGCGGCTAGAGA
CGTAGTTACCATG
GTAACAACCATAACTCCCCTAGCAAGCCAATTTTACCTCATGACGCACATTGTGTTCATGATCATTCCCATGTACTTCTCATAATGATTTTGAGCTTTATTCTAAAT
CCAATATATAAGGCATATGAAGCTCGTTTGATTTCTACCTTGTTCACTAGATTAGTTCTAGCATGCTCGCAATTACTACACAAGATTCACTCAAAAAACTCCAAACAACTGGTTTCTAAT
GAATTACAGCAACAAGTGAGTCCAGTAAACTCGACTATCATTTCAGAAAAAAGGCTAGACTATCGCAGTTTTAGAAAGGCAGTATCTATGAAAATAAACCAGCAAGCCCGAGAGAAAAAG
GAAAAGAGTTTCAAATGGTTTCCTATCTTATTACTGCATTCTGTGGTCTTGTAGTTATCACTTGATTCGCTTAAAAAGTTATTCCCTCGATAAAAGAAAAATTACTAAGGTGCTCCACAC
ATTGAACTAATTACTAACCCCTCGAGATAGTTATTATGGCATAATATTGCCTATTGTTTTCATTGTTAAGGCTGGAGGGCCATCTTGGAACGTGCTGAAAGGCAGAAAAGATGGAAGAGT
ATCAAATGCTTCAGAGACGATCAACTTGCCGGCGCCAACCTTCAACGTAACCCAACTCCTTCAAAGCTTTGCCGAAAGAGGCTTAGGCCTCAAGGACTTGGTTGCACTATCTGGTGGCCA
CACCCTGGGCTTCTCACACTGTTCCTCTTTCGACGCCCGGCTTCGTAACTTCTCTTCGACTCATGACATAGATCCGACTTTGAACCATGCGTTCGCACAACTGCTGAAGAATGAGTGCCC
TAAACCAAACAGGAATCGAAATGCGGGACAGTTTCTGGATGCTACATCGTCAACTTTTGACAACGATTACTACAGAAGACTCGTGGCTGGTGAAGGTGTGTTTGGGTCAGATCAAGCACT
GTATAGTGATTACAGGACAAGGTGGATTGTAAATTTGTTTGCCCAAGATCAAAGTCTGTTCTTCAGTGAGTTTGCAGCTTCTATGGTAAGACTCGGAAATGTTGGAGTGCGAGAAAATGG
AGAAGTGAGAATAAAATGCAGAGCGGTGAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGTCCTTGCGCTGAAGCCTCGCTCTCGCGTGATTTTCGCCCTTCTACTGGCGATGGTTTCGGTATCGAGAGCCACACTCGATGCCCATTATTATGACCAGACATGTCCACAAGCT
GAGAAAATCATATTGCAGACGGTTCAAAATGCCACAAGGCACGACCCCAAAGTCCCCGCTCGTCTCCTAAGGATGTTCTTCCACGACTGTTTCATTCGG
GGATGCGATGCGTCGTTGTTG
CTCGACTCAACTCCTGGAAACCAAGCAGAGAAAGATGGTCCTCCAAATATCTCGGTTCGAGCATTCTACGTGATCGATGATGCCAAAGCAAAGCTCGAAATGGCATGTCCACATACAGTC
TCTTGTGCTGATATCATCGCCATTGCGGCTAGAGACGTAGTTACCATG
GCTGGAGGGCCATCTTGGAACGTGCTGAAAGGCAGAAAAGATGGAAGAGTATCAAATGCTTCAGAGACGATC
AACTTGCCGGCGCCAACCTTCAACGTAACCCAACTCCTTCAAAGCTTTGCCGAAAGAGGCTTAGGCCTCAAGGACTTGGTTGCACTATCTGGTGGCCACACCCTGGGCTTCTCACACTGT
TCCTCTTTCGACGCCCGGCTTCGTAACTTCTCTTCGACTCATGACATAGATCCGACTTTGAACCATGCGTTCGCACAACTGCTGAAGAATGAGTGCCCTAAACCAAACAGGAATCGAAAT
GCGGGACAGTTTCTGGATGCTACATCGTCAACTTTTGACAACGATTACTACAGAAGACTCGTGGCTGGTGAAGGTGTGTTTGGGTCAGATCAAGCACTGTATAGTGATTACAGGACAAGG
TGGATTGTAAATTTGTTTGCCCAAGATCAAAGTCTGTTCTTCAGTGAGTTTGCAGCTTCTATGGTAAGACTCGGAAATGTTGGAGTGCGAGAAAATGGAGAAGTGAGAATAAAATGCAGA
GCGGTGAACTGA

Retrieve as FASTA