Entry information : SbPrx12 (Sobic.001G314000.1[2.1]SB01G030530[1.4])
Entry ID 812
Creation 2006-01-06 (Christophe Dunand)
Last sequence changes 2006-01-06 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-01 (Messaoudi)
Peroxidase information: SbPrx12 (Sobic.001G314000.1[2.1]SB01G030530[1.4])
Name (synonym) SbPrx12 (Sobic.001G314000.1[2.1]SB01G030530[1.4])
Class Class III peroxidase    [Orthogroup: Prx014]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue types Callus
Roots
Seedlings
Inducers Acid treatment
Alkaline treatment
Nitrogen starvation
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx12
start..stop
S start..stop
ZmPrx05 581 0 6..325 1..319
SiPrx164 569 0 1..325 1..323
OsPrx128 532 0 6..325 10..338
SofPrx07 521 0 3..291 4..294
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 53029955..53030176 222 N° 2 53029623..53029811 189 N° 3 53028618..53029184 567  
complement(join(53028618..53029184,53029623..53029811,53029955..53030176))


exon

Literature and cross-references SbPrx12 (Sobic.001G314000.1[2.1]SB01G030530[1.4])
Literature Cordonnier-Pratt,M.-M. et al., unpublished
DNA ref. Phytozome 12:   chromosome_1 (53030176..53028618)
EST ref. GenBank:   CF431923 [5' end]
Cluster/Prediction ref. PlantGDB:   SbGSStuc11-12-04.9892.1
Protein sequence: SbPrx12 (Sobic.001G314000.1[2.1]SB01G030530[1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325
PWM (Da):   %s   33698.79  
PI (pH):   %s   6.5
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAVQRMEVLYLQVAAVAALLMATELRAQLRVGFYDNSCPAAEIIVQQEVSTAVAANPGIAAGLLRLHFHDCFVGGCDASVLIDSTKGNTAEKDAGPNTSLRGFEVIDRIKARVEQACFGVVSCADILAFAARDSVALAGGNAYQVPAGRRDGSTSRASDTNGNLPPPTANVAQLTKIFGNKGLTQKEMVILSGAHTIGSSHCSSFSGRLSSSSTTAGQDPTMDPAYVAQLARQCPQAGGDPLVAMDYVSPNAFDEGFYKGVMANRGLLSSDQALLSDKNTAVQVVTYANDPATFQSDFAAAMVKMGTVGVLTGASGKIRANCRVA*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, introns 1 and 2) and 10 ESTs
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGTGCAGAGGATGGAGGTACTGTACTTGCAGGTGGCGGCGGTGGCGGCGCTGCTGATGGCGACGGAGCTGCGCGCGCAGCTGCGGGTGGGCTTCTACGACAACTCGTGCCCTGCG
GCGGAGATCATCGTGCAGCAGGAGGTGAGCACGGCGGTGGCGGCCAACCCGGGCATCGCCGCCGGCCTGCTCCGGCTCCACTTCCACGACTGCTTCGTTGGG
GTCAGTCCATCCTCAGTC
GCAAGCTCGCGTCGCTCGCAGCTACCCATACTCACTACAAAGAAAGCAAGGACGAGCTGACTGCAAATGCAGCAGCAGGGTGACAGAACAGAACTGACTGTGATGCCTTGCTGGAAAACT
TGCAGGGGTGCGACGCGTCGGTGCTCATCGACTCGACCAAGGGCAACACCGCGGAGAAGGACGCCGGGCCAAACACCAGCCTGCGGGGCTTCGAGGTCATCGACCGCATCAAGGCGCGCG
TCGAGCAGGCCTGCTTCGGCGTCGTCTCCTGCGCGGACATACTCGCCTTCGCCGCCAGGGACAGCGTCGCACTG
GTAAGCTACAGGACTGTAAGACAATTCATCATTTAATTAGTCTATT
AAGATTGCAAAGCTGCATTTGTCAATACTAAACTGCATCTTGCTTTACTGTCAGTGGACGGTGGTGGTAGCACTGCTTCAGTGATAGATAAACTTTTTCTTTTTTAACCCGACATGATTG
CATGAATTTGGAATCCAAAGCTGGACTGTCATAGGATTAGACAGAAAAGCATATGTATCTGATGTTTCTGTCTCCCATCTTTTTTGACGCACATTGCCCCCACCACATGATGCCGCGCGC
AGCTTGCATATGCACGCCACAAAGAGAAAGAACTCGATATGATGCCACATGCCAGCAGCCCGGCATGGGTCCAACTAGTATCACGCTTAATTAGCACGCACGCCATTGTCGCGTTCTATT
CTAACGAATTCTTCGTACGTACGCGCGTGCAGGCCGGTGGTAACGCGTACCAGGTGCCGGCGGGTCGCCGCGACGGGTCCACGTCGCGCGCGTCGGACACGAACGGCAACCTGCCGCCGC
CGACGGCGAACGTGGCCCAGCTCACGAAGATCTTCGGCAACAAGGGCCTGACGCAGAAGGAGATGGTGATCCTCTCCGGCGCGCACACCATCGGGTCCTCGCACTGCAGCTCCTTCAGCG
GGCGGCTGTCGAGTTCGTCCACGACGGCGGGGCAGGACCCGACCATGGACCCGGCGTACGTGGCGCAGCTGGCGCGGCAGTGCCCGCAGGCCGGCGGGGACCCGCTGGTGGCCATGGACT
ACGTGTCCCCGAACGCCTTCGACGAGGGCTTCTACAAGGGCGTCATGGCCAACCGCGGCCTGCTGTCCTCGGACCAGGCGCTGCTCAGCGACAAGAACACCGCCGTGCAGGTCGTCACCT
ACGCCAACGACCCGGCCACGTTCCAGAGCGACTTCGCCGCGGCCATGGTCAAGATGGGCACCGTCGGCGTGCTCACCGGAGCCAGCGGCAAGATCAGGGCAAACTGCAGAGTCGCCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGTGCAGAGGATGGAGGTACTGTACTTGCAGGTGGCGGCGGTGGCGGCGCTGCTGATGGCGACGGAGCTGCGCGCGCAGCTGCGGGTGGGCTTCTACGACAACTCGTGCCCTGCG
GCGGAGATCATCGTGCAGCAGGAGGTGAGCACGGCGGTGGCGGCCAACCCGGGCATCGCCGCCGGCCTGCTCCGGCTCCACTTCCACGACTGCTTCGTTGGG
GGGTGCGACGCGTCGGTG
CTCATCGACTCGACCAAGGGCAACACCGCGGAGAAGGACGCCGGGCCAAACACCAGCCTGCGGGGCTTCGAGGTCATCGACCGCATCAAGGCGCGCGTCGAGCAGGCCTGCTTCGGCGTC
GTCTCCTGCGCGGACATACTCGCCTTCGCCGCCAGGGACAGCGTCGCACTG
GCCGGTGGTAACGCGTACCAGGTGCCGGCGGGTCGCCGCGACGGGTCCACGTCGCGCGCGTCGGACACG
AACGGCAACCTGCCGCCGCCGACGGCGAACGTGGCCCAGCTCACGAAGATCTTCGGCAACAAGGGCCTGACGCAGAAGGAGATGGTGATCCTCTCCGGCGCGCACACCATCGGGTCCTCG
CACTGCAGCTCCTTCAGCGGGCGGCTGTCGAGTTCGTCCACGACGGCGGGGCAGGACCCGACCATGGACCCGGCGTACGTGGCGCAGCTGGCGCGGCAGTGCCCGCAGGCCGGCGGGGAC
CCGCTGGTGGCCATGGACTACGTGTCCCCGAACGCCTTCGACGAGGGCTTCTACAAGGGCGTCATGGCCAACCGCGGCCTGCTGTCCTCGGACCAGGCGCTGCTCAGCGACAAGAACACC
GCCGTGCAGGTCGTCACCTACGCCAACGACCCGGCCACGTTCCAGAGCGACTTCGCCGCGGCCATGGTCAAGATGGGCACCGTCGGCGTGCTCACCGGAGCCAGCGGCAAGATCAGGGCA
AACTGCAGAGTCGCCTGA

Retrieve as FASTA