Entry information : EgrPrx154 (Eucgr.J01619 / Egrandis_v1_0.046460m)
Entry ID 8122
Creation 2011-02-04 (Christophe Dunand)
Last sequence changes 2011-02-07 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-09 (Qiang Li)
Peroxidase information: EgrPrx154 (Eucgr.J01619 / Egrandis_v1_0.046460m)
Name (synonym) EgrPrx154 (Eucgr.J01619 / Egrandis_v1_0.046460m)
Class Class III peroxidase    [Orthogroup: Prx003]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx154
start..stop
S start..stop
EglPrx154 647 0 1..315 1..315
EgrPrx153 647 0 1..315 1..315
EguPrx153 646 0 1..315 1..315
EglPrx153 642 0 1..315 1..315
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 21110055..21110234 180 N° 2 21110530..21111297 768  
join(21110055..21110234,21110530..21111297)


exon

Literature and cross-references EgrPrx154 (Eucgr.J01619 / Egrandis_v1_0.046460m)
DNA ref. Phytozome 11:   scaffold_10 (21110055..21111297)
Protein sequence: EgrPrx154 (Eucgr.J01619 / Egrandis_v1_0.046460m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   316
PWM (Da):   %s   33850.83  
PI (pH):   %s   8.21
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFSFITFLNSGSATLQVGFYRSTCPSAESVVRKAVNKAVAKNPGIGAGLIRMHFHDCFVRGCDASILLDSTPGNPSEKEHPANNPSLRGFEVIDEAKAELESLCPQKVSCADILAFAARDSAYKLGSINYAVPAGRRDGLVSLKDEPSQNLPPFFFNAQQLEANFASKGLSLDEMVTLSGAHSIGVSHCSSFSDRLYSFNATHTQDPSMDTKLASQLKSKCPNNGGASDPTVPLDLVTPNRLDNKYYTNLKNHRGLLTSDQTLFNSPSTANIVRSNANNGGAWANKFAAAMVKMGSIDVLTGSEGEIRRKCRVVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (Egrandis_v1_0.046460m, scaffold_10, 21110055 - 21111288). Incorrect prediction from phytozome (short 3' end and stop codon missing which has been completed).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCTCGTTCATCACCTTTCTGAACTCGGGTTCAGCAACTCTCCAAGTGGGATTCTACCGCTCCACTTGTCCGTCTGCGGAGTCCGTCGTCCGGAAAGCAGTGAACAAAGCGGTGGCC
AAGAACCCTGGCATCGGTGCTGGGCTTATTAGAATGCACTTCCATGATTGCTTTGTTCGG
GTATGCAAGAACTTCTTTACACATTTCAGAAGTAGTGGTTATAATCTCGTTTGCGGAAAA
ATTGTAATGCAAGGAAAACCTTTTTTGTTTAAGCAAAAAGCGTATGCCTATCTTTTGTTAGTACAAAAGATATCGATGAGATGGGAGTGTGGGGAGTACATTTCACATTCTATCACTGGT
CCAGGACTTTTTAAGTTTTGTCTAACCGACCGGTCACAAAATAATCTATATTTCTTATGCAGATGCACTTCAGCTATCCTGATAATTAATTGGCTGATCTTTGATCCAATAATAGGGTTG
CGATGCTTCAATCTTGCTGGATTCGACCCCAGGCAACCCATCAGAGAAGGAACATCCCGCAAACAACCCGAGCTTGCGAGGTTTTGAAGTCATCGATGAGGCGAAGGCTGAGCTAGAGTC
TCTATGCCCGCAGAAGGTCTCATGCGCTGACATTCTTGCATTCGCAGCACGCGACAGTGCCTACAAACTCGGCAGCATCAACTACGCAGTCCCAGCGGGTCGCCGCGATGGGCTGGTCTC
ACTCAAAGACGAGCCCTCCCAGAATCTTCCTCCTTTCTTCTTCAATGCGCAACAATTAGAAGCTAATTTTGCGAGCAAAGGCCTCTCTCTGGACGAGATGGTGACGCTATCCGGTGCACA
TTCGATTGGAGTCTCGCATTGCTCCTCCTTCTCGGACCGCTTGTACTCCTTCAATGCCACTCACACCCAAGACCCTTCAATGGACACCAAGTTAGCTAGTCAACTGAAATCTAAGTGTCC
GAACAATGGAGGCGCTAGCGATCCCACTGTGCCATTGGACTTGGTCACGCCGAACAGGCTAGACAACAAGTACTACACTAATTTGAAGAACCACCGAGGCCTATTGACTTCTGATCAGAC
TCTTTTTAACAGCCCTTCAACGGCTAATATCGTGAGGAGCAATGCAAATAATGGCGGAGCATGGGCTAACAAGTTCGCGGCAGCAATGGTGAAGATGGGATCGATCGACGTCCTCACTGG
GAGTGAGGGTGAGATTAGGAGGAAATGCAGAGTGGTGAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCTCGTTCATCACCTTTCTGAACTCGGGTTCAGCAACTCTCCAAGTGGGATTCTACCGCTCCACTTGTCCGTCTGCGGAGTCCGTCGTCCGGAAAGCAGTGAACAAAGCGGTGGCC
AAGAACCCTGGCATCGGTGCTGGGCTTATTAGAATGCACTTCCATGATTGCTTTGTTCGG
GGTTGCGATGCTTCAATCTTGCTGGATTCGACCCCAGGCAACCCATCAGAGAAGGAACAT
CCCGCAAACAACCCGAGCTTGCGAGGTTTTGAAGTCATCGATGAGGCGAAGGCTGAGCTAGAGTCTCTATGCCCGCAGAAGGTCTCATGCGCTGACATTCTTGCATTCGCAGCACGCGAC
AGTGCCTACAAACTCGGCAGCATCAACTACGCAGTCCCAGCGGGTCGCCGCGATGGGCTGGTCTCACTCAAAGACGAGCCCTCCCAGAATCTTCCTCCTTTCTTCTTCAATGCGCAACAA
TTAGAAGCTAATTTTGCGAGCAAAGGCCTCTCTCTGGACGAGATGGTGACGCTATCCGGTGCACATTCGATTGGAGTCTCGCATTGCTCCTCCTTCTCGGACCGCTTGTACTCCTTCAAT
GCCACTCACACCCAAGACCCTTCAATGGACACCAAGTTAGCTAGTCAACTGAAATCTAAGTGTCCGAACAATGGAGGCGCTAGCGATCCCACTGTGCCATTGGACTTGGTCACGCCGAAC
AGGCTAGACAACAAGTACTACACTAATTTGAAGAACCACCGAGGCCTATTGACTTCTGATCAGACTCTTTTTAACAGCCCTTCAACGGCTAATATCGTGAGGAGCAATGCAAATAATGGC
GGAGCATGGGCTAACAAGTTCGCGGCAGCAATGGTGAAGATGGGATCGATCGACGTCCTCACTGGGAGTGAGGGTGAGATTAGGAGGAAATGCAGAGTGGTGAACTAG

Retrieve as FASTA