Entry information : EgrAPx10 ( Eucgr.J00965 / Egrandis_v1_0.024164m)
Entry ID 8123
Creation 2011-02-04 (Christophe Dunand)
Last sequence changes 2011-12-08 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-01-15 (Christophe Dunand)
Peroxidase information: EgrAPx10 ( Eucgr.J00965 / Egrandis_v1_0.024164m)
Name (synonym) EgrAPx10 ( Eucgr.J00965 / Egrandis_v1_0.024164m)
Class Ascorbate peroxidase    [Orthogroup: APx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrAPx10
start..stop
S start..stop
EglAPx10 513 0 1..250 1..250
EguAPx10 508 0 1..250 1..250
EcamAPx10 507 0 1..248 1..248
EgrAPx03 461 1e-167 1..250 1..249
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 10501325..10501443 119 N° 2 10501554..10501728 175 N° 3 10501900..10501965 66 N° 4 10502765..10502813 49
N° 5 10502912..10502997 86 N° 6 10503212..10503291 80 N° 7 10503386..10503488 103 N° 8 10503563..10503621 59
N° 9 10503719..10503734 16  
join(10501325..10501443,10501554..10501728,10501900..10501965,10502765..10502813 ,10502912..10502997,10503212..10503291,10503386..10503488,10503563..10503621,105 03719..10503734)


exon

Literature and cross-references EgrAPx10 ( Eucgr.J00965 / Egrandis_v1_0.024164m)
DNA ref. Phytozome 12:   scaffold_10 (10501325..10503734)
Protein sequence: EgrAPx10 ( Eucgr.J00965 / Egrandis_v1_0.024164m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   250
PWM (Da):   %s   27245.91  
PI (pH):   %s   6.72
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGKSYPTVSEEYKKAVEKCKKKLRGLIAEKSCAPLMLRIAWHSAGTFDVKTKTGGPFGTMKHAAELSHGANSGLDVAVRLLQPIKDQFPVITYADFYLAGVVAVEVTGGPEVAFHPGREDKPQPPPEGRLPDATKGCDHLRQVFGVQMGLSDKDIVALSGGHTGRCHKERSGFEGTWTANPLIFDNSYFKELLSGEKKELLQLPSDKALLADPVFRPLVEKYADEDAFFEDYAEAHLKLSELGFADA

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction from phytozome. Two other alternative transcript predicted by phytozome (Egrandis_v1_0.024171m (100% identical) and Egrandis_v1_0.024783m (last exon is missing)).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGAAGTCCTACCCGACCGTGAGCGAGGAGTACAAGAAGGCTGTCGAGAAATGCAAGAAGAAGCTGAGAGGCCTCATCGCTGAGAAGAGCTGCGCTCCGCTCATGCTCCGTATCGCG
TACGATCTCTCTCTCTCTCTCTCTTTCTCTCTTTGACTGGCGATCTCATGGTGCGAGGATTTGTGTGACGTTGGGTGTTTATGTGGGTGTGTGTGTGTGCGTCGTGCAGGTGGCACTCCG
CCGGTACCTTCGATGTGAAGACGAAGACCGGAGGCCCGTTCGGGACCATGAAGCACGCCGCGGAGCTCAGCCACGGGGCCAACAGCGGGCTCGACGTTGCCGTCAGGCTCTTGCAGCCGA
TCAAGGATCAGTTCCCCGTCATCACTTATGCTGATTTCTACCAG
GTCTGTTTCTTTGTTCTGTTTTTAACTATGCGGACATAGGGAAGAGCGGGCCTTGCGATCGGGTTGTTTTGATGGC
TTTAAAGCATTCATATGCAGCGGTCGACGGCCATTTCGTTCCGAATAACATGCATTTATGACCTTGTCTTGATGATGTTGTCCAATGTGATACAGCTGGCTGGCGTCGTTGCTGTGGAAG
TTACTGGTGGACCTGAAGTTGCTTTTCACCCCGGAAGAGAG
GTCGGTGATCTTGTTTGCTTTCTTTTTATCGTAGCAGGATCTATGTTTTCCTATATGATCTATATACACACAGATGTGA
CGTGATTTATGTTTCCAAGAGTTGCAATGTCGATGTGTCTAGAAGCAGAAGAGGGTTGATGAAGATCAGTGCAATTCTACTATTATCAAGCAGAAAATAGTTATTATATTAACCAAAACC
GTTTGGTCGTTACATGGTATCTGGTTTGATGCCTTCTCTCATTAGGCATGTTAAAATTATTTACAACTGTTGTTCTTTTGCCCCTTTAACCTGATCACTTGGATCTTATGTTTCTTTCAT
GGAATTGTGGGTGATATATTGACGTTCTGATGGTGAAGTAAAACCATTCACTTGTTTTTAGGTTCTTTCTTTCAGGAAACTTCACTATATATATGTATGTATGTATGTATTCTTCAGCTC
ACTTTAAAGCTACACTGTTGTGTGTTTTGGTTAGCTGAACTTGGTAGTGCAAGCCTGGGCACTTGTGCTCCCTCTTCATCATAGCATATAAGTGCTGTAATGATTTCTGAAAATTTCCAA
AAGATCTACTGATATGCTTTGAGATATGTAAGCCACGTGAGGCCTCTCCTTATGGATTTCTGATCAGATGCTGTACTGTGATTTGTGCTGTCAACGGCCTAGAAGCTTTTGCTTTCTCTT
GGTTCACATCTTTTTTTATACTTTCTTCGCAATTTTCCATAATGTCTGTTAGCTTTAATTGTGATGCTTGCTACTTTGTTATTTATCTGGCATATTTTCACATTTTTCCACCAAATCCAG

GACAAACCACAACCACCTCCCGAGGGCCGTCTTCCTGATGCTACCAAGG
GTTAGTTTTATGTCTAGCATTTCCAGTATTTTGTCTTCATGCTTTTAGATTCTTGATTGAATGTTAATCTA
TCGTCGTGTCTTCGACATTTCTTGCAGGCTGTGACCACTTGAGACAAGTGTTTGGTGTTCAGATGGGCCTTTCTGACAAGGATATTGTGGCCCTCTCTGGTGGCCATACCCTGGTTTGTG
CTCAAACCTTAGATCCTCTCTTGAATTCTGATTTTGTTAAGTAGGATACTATTTGTAGCAAGTTGCAGTCATATGCCATCCTATTTGCCTACAAATTATATTGGTTTTATTCTCCTTCGT
GGTGATATGCTCTGTAAGTTCTGATGTAATTATTCAATTATCGCATTTAGTTCATTCCTTTGCTCTTTTGGTGGCACTCAATAACAGGGAAGGTGCCACAAGGAGAGGTCTGGATTTGAG
GGAACCTGGACCGCAAATCCCCTCATATTCGACAACTCGTACTTCAA
GTGAGGCTTCTAATCTTCCCGTTTTTAATCCATTGTCGGATAAAGTAATTGCCAACTTCATGCTCATGCGGTG
ACTGTTTGAATCTTCGACTAGGGAATTGTTGAGCGGAGAGAAGAAAGAACTTCTTCAGCTGCCAAGTGATAAGGCTCTTCTTGCTGACCCTGTTTTCCGCCCTCTTGTTGAGAAATATGC
TGCG
GTGTGTGTTTTTCTCTTGTCGAGAATTGCTGTGCCGTTGTATGCTGGAGCTCATTGACTTTCCTTTTGATTTAGGATGAAGATGCCTTCTTTGAAGACTATGCTGAAGCCCATCTG
AAGCTCTCTGAGCTAGG
GTACTCTTTAAATTTTTATGGTCATTCTACACTTATTGTATACTTTAGTCGATTTCTTTGGCCAATGTTGTCATTGAACTCTTGACTTCTTTCGCAGGTTTGC
TGATGCCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGAAGTCCTACCCGACCGTGAGCGAGGAGTACAAGAAGGCTGTCGAGAAATGCAAGAAGAAGCTGAGAGGCCTCATCGCTGAGAAGAGCTGCGCTCCGCTCATGCTCCGTATCGCG
TGGCACTCCGCCGGTACCTTCGATGTGAAGACGAAGACCGGAGGCCCGTTCGGGACCATGAAGCACGCCGCGGAGCTCAGCCACGGGGCCAACAGCGGGCTCGACGTTGCCGTCAGGCTC
TTGCAGCCGATCAAGGATCAGTTCCCCGTCATCACTTATGCTGATTTCTACCAG
CTGGCTGGCGTCGTTGCTGTGGAAGTTACTGGTGGACCTGAAGTTGCTTTTCACCCCGGAAGAGAG
GACAAACCACAACCACCTCCCGAGGGCCGTCTTCCTGATGCTACCAAGGGCTGTGACCACTTGAGACAAGTGTTTGGTGTTCAGATGGGCCTTTCTGACAAGGATATTGTGGCCCTCTCT
GGTGGCCATACCCTG
GGAAGGTGCCACAAGGAGAGGTCTGGATTTGAGGGAACCTGGACCGCAAATCCCCTCATATTCGACAACTCGTACTTCAAGGAATTGTTGAGCGGAGAGAAGAAA
GAACTTCTTCAGCTGCCAAGTGATAAGGCTCTTCTTGCTGACCCTGTTTTCCGCCCTCTTGTTGAGAAATATGCTGCG
GATGAAGATGCCTTCTTTGAAGACTATGCTGAAGCCCATCTG
AAGCTCTCTGAGCTAGG
GTTTGCTGATGCCTAA

Retrieve as FASTA