Entry information : EgrPrx33
Entry ID 8147
Creation 2011-02-25 (Qiang Li)
Last sequence changes 2011-03-03 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-02-15 (Qiang Li)
Peroxidase information: EgrPrx33
Name EgrPrx33
Class Class III peroxidase    [Orthogroup: Prx041]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx33
start..stop
S start..stop
EgrPrx36 658 0 1..323 1..323
EgrPrx39 657 0 1..323 1..323
EguPrx39 654 0 1..323 1..323
EguPrx36 653 0 1..323 1..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 11195323..11195550 228 N° 2 11195030..11195224 195 N° 3 11194296..11194844 549  
complement(join(11194296..11194844,11195030..11195224,11195323..11195550))


exon

Literature and cross-references EgrPrx33
DNA ref. Phytozome 12:   scaffold_1 (11195550..11194296)
Protein sequence: EgrPrx33
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (300)
PWM (Da):   %s   35109.55 (32731.3)  
PI (pH):   %s   6.03 (6.03) Peptide Signal:   %s   cut: 24 range:24-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALNSLSLVQALLFLSLATSAFSTRPYKEGLTPYFYDYVCPQALPAIKRVVEAAVQQERRMGASLLRLHFHDCFVNGCDASILLDPTPTIDSEKFANPNNNSARGFEVIDQIKAEVDKACGYSLVSCADILAVAARDSVVALGGPSWEVQLGRRDSTTASRTTANSDIPAPNMDLPALINTFQKQGLDTRDLVALSGAHTIGFAQCVNFRNRTYNDDNVATSFARSLRSLCPRTGEDGNLAGLDPSPAQFDALYFHNLLAQKGLLHSDQALYSGGSTDELVKTYSDDAEAFWDYFAKSMIKMGNIKPLIGNQGQIRSNCRRLN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, introns 1 and 2). No prediction from Phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTAAATAGCCTCAGCCTCGTCCAAGCACTTCTCTTCTTGTCTCTCGCGACCTCGGCTTTCTCGACGCGGCCCTACAAGGAAGGCCTCACGCCATACTTCTACGACTACGTTTGT
CCTCAAGCCTTGCCCGCCATCAAACGCGTTGTCGAGGCAGCGGTGCAACAGGAGCGACGCATGGGCGCTTCGTTACTCCGTTTGCACTTCCACGATTGTTTCGTTAAC
GTACGACACATT
CACGATAGTCTTGATTCGCATTGGTTATCTAGCAGCCGGCATAAATTTGCTAACTTGATTCTTGTTTTATCCACGTCATAATGTAGGGTTGCGATGCTTCAATACTTTTGGATCCGACCC
CTACCATTGACAGCGAAAAGTTCGCGAACCCGAATAACAATTCGGCTAGAGGGTTCGAAGTGATCGATCAAATTAAGGCGGAGGTCGACAAAGCTTGCGGATACTCACTTGTATCATGTG
CCGACATCTTGGCCGTCGCAGCCCGTGACTCGGTAGTTGCG
GTATGTCTTATCTTAATGCTACATATGATGCCTTCATTTAAGCAAAACTACAGTGCAGACAAATAGAAGAGAGAGTCTC
CCGCTAATTGAACACGCTAGGCGTAGAATCATATGCACATACATAATCTTTCGATTATCTAAGCAAAGCTGAATTTGAACTTAAAAGGTTGACTGAAATATTTCAGCTGGGAGGGCCTTC
ATGGGAAGTACAACTTGGAAGGAGGGACTCGACCACGGCGAGCAGGACAACCGCCAACTCCGACATTCCCGCGCCGAACATGGACTTGCCTGCACTGATCAACACGTTCCAAAAGCAAGG
TCTCGACACTCGGGACTTGGTCGCGCTGAGCGGTGCTCACACAATCGGGTTCGCTCAATGTGTCAATTTCAGAAACCGCACATACAACGACGACAACGTCGCCACCAGTTTTGCCAGGAG
CCTCCGGTCTTTGTGCCCGCGTACTGGAGAGGACGGGAACCTCGCTGGTTTGGATCCTTCGCCGGCTCAATTCGATGCATTGTACTTCCATAATCTGCTGGCGCAGAAGGGGCTTCTTCA
TTCTGATCAGGCGCTTTACAGTGGTGGGTCAACGGATGAGCTGGTGAAAACTTACAGTGATGATGCGGAGGCCTTTTGGGATTATTTTGCAAAGTCGATGATCAAGATGGGAAACATAAA
GCCGTTGATCGGAAACCAGGGCCAGATTCGCTCAAATTGCCGAAGGTTGAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTAAATAGCCTCAGCCTCGTCCAAGCACTTCTCTTCTTGTCTCTCGCGACCTCGGCTTTCTCGACGCGGCCCTACAAGGAAGGCCTCACGCCATACTTCTACGACTACGTTTGT
CCTCAAGCCTTGCCCGCCATCAAACGCGTTGTCGAGGCAGCGGTGCAACAGGAGCGACGCATGGGCGCTTCGTTACTCCGTTTGCACTTCCACGATTGTTTCGTTAAC
GGTTGCGATGCT
TCAATACTTTTGGATCCGACCCCTACCATTGACAGCGAAAAGTTCGCGAACCCGAATAACAATTCGGCTAGAGGGTTCGAAGTGATCGATCAAATTAAGGCGGAGGTCGACAAAGCTTGC
GGATACTCACTTGTATCATGTGCCGACATCTTGGCCGTCGCAGCCCGTGACTCGGTAGTTGCG
CTGGGAGGGCCTTCATGGGAAGTACAACTTGGAAGGAGGGACTCGACCACGGCGAGC
AGGACAACCGCCAACTCCGACATTCCCGCGCCGAACATGGACTTGCCTGCACTGATCAACACGTTCCAAAAGCAAGGTCTCGACACTCGGGACTTGGTCGCGCTGAGCGGTGCTCACACA
ATCGGGTTCGCTCAATGTGTCAATTTCAGAAACCGCACATACAACGACGACAACGTCGCCACCAGTTTTGCCAGGAGCCTCCGGTCTTTGTGCCCGCGTACTGGAGAGGACGGGAACCTC
GCTGGTTTGGATCCTTCGCCGGCTCAATTCGATGCATTGTACTTCCATAATCTGCTGGCGCAGAAGGGGCTTCTTCATTCTGATCAGGCGCTTTACAGTGGTGGGTCAACGGATGAGCTG
GTGAAAACTTACAGTGATGATGCGGAGGCCTTTTGGGATTATTTTGCAAAGTCGATGATCAAGATGGGAAACATAAAGCCGTTGATCGGAAACCAGGGCCAGATTCGCTCAAATTGCCGA
AGGTTGAACTGA

Retrieve as FASTA