Entry information : EgrPrx41
Entry ID 8148
Creation 2011-02-25 (Qiang Li)
Last sequence changes 2011-03-01 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-02-15 (Qiang Li)
Peroxidase information: EgrPrx41
Name EgrPrx41
Class Class III peroxidase    [Orthogroup: Prx041]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx41
start..stop
S start..stop
EguPrx41 660 0 1..321 1..321
EgrPrx38 655 0 1..321 1..321
EguPrx38 650 0 1..321 1..321
EgrPrx35 647 0 1..321 1..321
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 11261566..11261787 222 N° 2 11261908..11262102 195 N° 3 11262241..11262789 549  
join(11261566..11261787,11261908..11262102,11262241..11262789)


exon

Literature and cross-references EgrPrx41
DNA ref. Phytozome 12:   scaffold_1 (11261566..11262789)
Protein sequence: EgrPrx41
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   321 (300)
PWM (Da):   %s   35258.92 (33023.7)  
PI (pH):   %s   9.06 (9.06) Peptide Signal:   %s   cut: 22 range:22-321
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFLTLFQALLILSLTASTLSTRPYKNGLTPYFYDYVCPQALPAIKRVVEGAVQQERRMGASLLRLHFHDCFVNGCDGSILLDSTATIESEKFAAPNNNSARGFEVIDQIKAEVDRVCGHPVVSCADILAVTARDSVVALGGPSWKVRLGRRDSTTASRTTANNDIPAPNMDLPALINNFKRQGLKVKDLVALSGAHTIGFAQCFTFRNRTFNDSNINQAFAKNLRSYCPRTGSDSNLASLDPTPARFDTLYYNNLLTQKGLLHSDQALSTGESALELVKSYSHDYEAFWKDFAKSMVRMGNIKPLTGNQGQIRSNCRRLN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, introns 1 and 2). No prediction from Phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTTCTCACCCTCTTCCAAGCGCTTCTCATCTTGTCCCTCACGGCCTCAACTCTTTCGACTCGTCCTTACAAGAATGGCCTCACGCCATACTTCTACGACTACGTTTGCCCTCAA
GCCTTGCCTGCCATCAAGCGCGTCGTTGAGGGGGCGGTGCAGCAAGAGCGACGCATGGGCGCTTCCTTGCTGCGCTTGCACTTTCACGACTGTTTCGTCAAT
GTAAGACATATATGTGCC
AGCTAACTTTCACATTAATCTGTTCTCAAAAATAGTGATTACTATTCAGCGTAACACAACATTTGCCAACATTGATTTATGTTTGGGTGTCGAATGATGCAGGGTTGTGATGGGTCGATA
CTCTTGGATTCAACCGCAACCATCGAGAGTGAAAAGTTCGCGGCTCCTAATAACAATTCGGCCAGAGGTTTCGAAGTGATCGACCAAATAAAGGCGGAGGTTGACAGAGTATGTGGACAT
CCCGTGGTTTCTTGTGCAGACATCTTGGCTGTCACCGCTCGTGACTCTGTCGTTGCG
GTACGTCTAGTTTTACTGCATCCCGTGATGACCATTAATCAGCAAATCTAAATGGAGACCATC
ATTGACTTAGTTGATTTTCATGCGCCGTAAGACATTGCCAATCCGAATTAGGTGTTAACTTCTTTCATATTTCAGTTAGGAGGGCCTTCGTGGAAAGTACGACTCGGACGAAGAGATTCG
ACGACGGCGAGCAGGACGACGGCAAACAACGACATCCCTGCGCCGAACATGGACTTACCCGCCTTAATTAACAATTTCAAGAGACAAGGCCTGAAGGTCAAGGACTTGGTCGCGCTGAGC
GGCGCTCACACAATCGGCTTCGCACAGTGCTTTACTTTCAGGAATAGGACATTCAATGACAGCAACATCAACCAGGCATTCGCAAAGAATCTCCGGTCCTACTGCCCGCGCACAGGAAGC
GACTCTAACCTCGCAAGTTTAGATCCCACGCCAGCGCGTTTCGACACATTGTACTACAATAACCTGTTGACCCAGAAGGGCCTTCTTCACTCTGATCAGGCACTGTCAACTGGTGAATCC
GCACTCGAGCTAGTGAAGAGCTATAGCCACGATTATGAAGCATTTTGGAAGGATTTCGCTAAATCGATGGTCAGGATGGGAAATATCAAGCCACTGACCGGAAACCAAGGTCAAATTCGC
TCGAATTGCCGGAGGTTGAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTTCTCACCCTCTTCCAAGCGCTTCTCATCTTGTCCCTCACGGCCTCAACTCTTTCGACTCGTCCTTACAAGAATGGCCTCACGCCATACTTCTACGACTACGTTTGCCCTCAA
GCCTTGCCTGCCATCAAGCGCGTCGTTGAGGGGGCGGTGCAGCAAGAGCGACGCATGGGCGCTTCCTTGCTGCGCTTGCACTTTCACGACTGTTTCGTCAAT
GGTTGTGATGGGTCGATA
CTCTTGGATTCAACCGCAACCATCGAGAGTGAAAAGTTCGCGGCTCCTAATAACAATTCGGCCAGAGGTTTCGAAGTGATCGACCAAATAAAGGCGGAGGTTGACAGAGTATGTGGACAT
CCCGTGGTTTCTTGTGCAGACATCTTGGCTGTCACCGCTCGTGACTCTGTCGTTGCG
TTAGGAGGGCCTTCGTGGAAAGTACGACTCGGACGAAGAGATTCGACGACGGCGAGCAGGACG
ACGGCAAACAACGACATCCCTGCGCCGAACATGGACTTACCCGCCTTAATTAACAATTTCAAGAGACAAGGCCTGAAGGTCAAGGACTTGGTCGCGCTGAGCGGCGCTCACACAATCGGC
TTCGCACAGTGCTTTACTTTCAGGAATAGGACATTCAATGACAGCAACATCAACCAGGCATTCGCAAAGAATCTCCGGTCCTACTGCCCGCGCACAGGAAGCGACTCTAACCTCGCAAGT
TTAGATCCCACGCCAGCGCGTTTCGACACATTGTACTACAATAACCTGTTGACCCAGAAGGGCCTTCTTCACTCTGATCAGGCACTGTCAACTGGTGAATCCGCACTCGAGCTAGTGAAG
AGCTATAGCCACGATTATGAAGCATTTTGGAAGGATTTCGCTAAATCGATGGTCAGGATGGGAAATATCAAGCCACTGACCGGAAACCAAGGTCAAATTCGCTCGAATTGCCGGAGGTTG
AATTGA

Retrieve as FASTA