Entry information : EgrPrx32
Entry ID 8151
Creation 2011-02-25 (Qiang Li)
Last sequence changes 2011-03-03 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-02-11 (Christophe Dunand)
Peroxidase information: EgrPrx32
Name EgrPrx32
Class Class III peroxidase    [Orthogroup: Prx041]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx32
start..stop
S start..stop
EglPrx32 664 0 1..323 1..323
EguPrx32 655 0 1..323 1..323
EgrPrx41 590 0 6..323 4..321
EgrPrx38 590 0 6..323 4..321
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 11191263..11191490 228 N° 2 11190950..11191144 195 N° 3 11190265..11190813 549  
complement(join(11190265..11190813,11190950..11191144,11191263..11191490))


exon

Literature and cross-references EgrPrx32
DNA ref. Phytozome 12:   scaffold_1 (11191490..11190265)
Protein sequence: EgrPrx32
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (300)
PWM (Da):   %s   35651.16 (33287.8)  
PI (pH):   %s   8.89 (8.72) Peptide Signal:   %s   cut: 24 range:24-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALGSLSLFRALLFLSLTASALSTRPYKNGLSPDFYDYVCPQALPTIKRVVEAAVQQERRMGASLLRLHFHDCFVNGCDRSILLDPTPTIDSEKLAFPNNNSARGFEVIDQIKAEVDRVCGRPVVSCADILAVTARDSVVELGGPSWKVRLGRRDSMTASRTTANSDIPAPNMDLPALINNFKRQGLKVKDLVALSGAHTIGFAQCRVFRDRIYNDSNINHAFAKNLQSSCPRTGSDTNLASLDPSPARFDTLYYNNLLTQKGLLHSDQALSTDESTLELVKSYSYDYDAFWKDFAKSMVRMGNIKPLIGNQGQIRSNCRRVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (Chromo 1, introns 1 and 2). No prediction from Phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTAGGTAGCCTCAGCCTCTTTCGAGCACTTCTCTTCTTGTCCCTCACGGCCTCGGCTCTCTCGACGCGCCCCTACAAGAATGGTCTCTCGCCAGACTTCTACGACTATGTCTGC
CCTCAAGCCTTGCCCACCATCAAGCGTGTCGTCGAGGCAGCGGTGCAGCAAGAAAGACGCATGGGCGCTTCCTTGCTGCGCTTGCACTTCCACGATTGTTTTGTCAAT
GTAAGACATATA
CTGCTAAATTTCACGTTAACTTGTTGTTCTCAAAAATAGTGATTACTATTTAGCAGTGCACAATATTTGCTGAACATTATGTATGTTTGGGCGTTGAATGATGCAGGGTTGTGATAGGTC
GATACTTTTGGATCCAACCCCAACCATTGACAGCGAAAAGCTTGCGTTTCCTAATAACAATTCAGCTAGAGGATTCGAAGTGATCGACCAAATTAAGGCAGAGGTTGACAGAGTATGCGG
ACGTCCGGTGGTATCTTGTGCGGACATTTTGGCTGTCACTGCTCGTGACTCCGTTGTTGAG
GTACGTCTAGTTTTACTACGTCCAATGATGATTAATTAGCAAATCTGAATTTAGACTCA
TCATAAGCTTAGTTGGCTTTTTTGTGCCTTAAGACATTGCCAATCTGAACTAGGCGCTATACTTCATTCAATTTCAGTTAGGGGGGCCTTCGTGGAAAGTACGACTTGGACGAAGAGACT
CGATGACGGCGAGCAGGACAACGGCAAACAGCGACATTCCTGCGCCAAACATGGACTTACCTGCCTTAATTAACAATTTCAAGAGACAAGGTCTTAAGGTCAAGGACTTGGTTGCACTAA
GCGGTGCTCACACGATTGGCTTCGCACAGTGCCGTGTTTTCAGGGACAGGATATACAATGACAGCAACATCAACCACGCTTTTGCGAAGAACCTCCAGTCCTCCTGCCCACGCACGGGAA
GCGACACAAACCTTGCAAGTTTAGATCCATCGCCGGCGCGTTTTGACACGTTGTACTACAATAACCTGTTGACCCAGAAGGGCCTTCTTCACTCTGATCAGGCACTTTCAACTGATGAAT
CCACACTTGAGCTAGTGAAGAGTTATAGCTACGATTATGATGCATTCTGGAAGGATTTCGCTAAATCGATGGTCAGAATGGGAAACATCAAGCCGTTGATCGGCAACCAAGGTCAAATCC
GCTCAAACTGCCGGAGAGTGAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTAGGTAGCCTCAGCCTCTTTCGAGCACTTCTCTTCTTGTCCCTCACGGCCTCGGCTCTCTCGACGCGCCCCTACAAGAATGGTCTCTCGCCAGACTTCTACGACTATGTCTGC
CCTCAAGCCTTGCCCACCATCAAGCGTGTCGTCGAGGCAGCGGTGCAGCAAGAAAGACGCATGGGCGCTTCCTTGCTGCGCTTGCACTTCCACGATTGTTTTGTCAAT
GGTTGTGATAGG
TCGATACTTTTGGATCCAACCCCAACCATTGACAGCGAAAAGCTTGCGTTTCCTAATAACAATTCAGCTAGAGGATTCGAAGTGATCGACCAAATTAAGGCAGAGGTTGACAGAGTATGC
GGACGTCCGGTGGTATCTTGTGCGGACATTTTGGCTGTCACTGCTCGTGACTCCGTTGTTGAG
TTAGGGGGGCCTTCGTGGAAAGTACGACTTGGACGAAGAGACTCGATGACGGCGAGC
AGGACAACGGCAAACAGCGACATTCCTGCGCCAAACATGGACTTACCTGCCTTAATTAACAATTTCAAGAGACAAGGTCTTAAGGTCAAGGACTTGGTTGCACTAAGCGGTGCTCACACG
ATTGGCTTCGCACAGTGCCGTGTTTTCAGGGACAGGATATACAATGACAGCAACATCAACCACGCTTTTGCGAAGAACCTCCAGTCCTCCTGCCCACGCACGGGAAGCGACACAAACCTT
GCAAGTTTAGATCCATCGCCGGCGCGTTTTGACACGTTGTACTACAATAACCTGTTGACCCAGAAGGGCCTTCTTCACTCTGATCAGGCACTTTCAACTGATGAATCCACACTTGAGCTA
GTGAAGAGTTATAGCTACGATTATGATGCATTCTGGAAGGATTTCGCTAAATCGATGGTCAGAATGGGAAACATCAAGCCGTTGATCGGCAACCAAGGTCAAATCCGCTCAAACTGCCGG
AGAGTGAATTGA

Retrieve as FASTA