Entry information : EgrPrx31
Entry ID 8153
Creation 2011-02-25 (Qiang Li)
Last sequence changes 2011-03-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-02-15 (Qiang Li)
Peroxidase information: EgrPrx31
Name EgrPrx31
Class Class III peroxidase    [Orthogroup: Prx041]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx31
start..stop
S start..stop
EguPrx31 667 0 1..323 1..323
EglPrx31 663 0 1..323 1..323
EcamPrx31 659 0 1..323 1..323
EguPrx28 610 0 1..323 1..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 11184795..11185022 228 N° 2 11185121..11185315 195 N° 3 11185489..11186037 549  
join(11184795..11185022,11185121..11185315,11185489..11186037)


exon

Literature and cross-references EgrPrx31
DNA ref. Phytozome 12:   scaffold_1 (11184795..11186037)
Protein sequence: EgrPrx31
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (300)
PWM (Da):   %s   35159.63 (32611.3)  
PI (pH):   %s   6.24 (5.96) Peptide Signal:   %s   cut: 24 range:24-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFSSLNFFRALLLLFLATSAFSTRPYKEGLTPHFYDYACPQALPAVQRIVEAAVQQERRMGASLLRLHFHDCFVNGCDASILLDPSPTIDSEKLAFPNNNSARGFEVIDQIKAEVDKACGYSLVSCADILAIAARDSVVALGGPSWEVQLGRRDSTRASRTTANTDIPAPNMDLPSLISTFQKQGLDTRDLVALSGAHTIGFAQCRVFRNRTYNDANIAADFAGSLRSLCPRTGEDSNLAGLDPSPAQFDALYFHNLLAQKGLLHSDQALYSGGSTDELVKTYSDDAEAFWDDFAKSMIKMGNIKPLIGNQGQIRLNCRKVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic. No prediction from Phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTTAGTAGCCTCAACTTCTTCCGAGCACTGCTCTTATTGTTCCTAGCGACGTCGGCTTTCTCGACGCGCCCTTACAAGGAAGGCCTCACGCCGCACTTCTACGACTACGCTTGT
CCTCAAGCTTTGCCTGCCGTCCAACGCATCGTGGAGGCAGCAGTGCAGCAGGAGCGACGCATGGGCGCTTCCTTACTGCGTTTGCACTTCCACGATTGTTTTGTTAAT
GTACGACATGTC
CACAATAATCTTAAGTTCGCACTGGTTATTTAGCGGGGCTCTCACATGTCCTAATTTGATCTGTTTCTATTTATGCAATAATGTAGGGTTGCGATGCTTCAATACTTTTGGATCCATCCC
CTACCATTGACAGCGAAAAGCTCGCGTTTCCAAATAACAATTCAGCTAGAGGATTTGAAGTGATCGACCAAATTAAAGCAGAGGTGGACAAAGCTTGTGGATACTCACTCGTATCTTGCG
CAGACATCTTGGCCATCGCAGCTCGTGACTCTGTTGTTGCG
GTACATCTAATCTTAACCTCACCTATATTGTGGGTCATTATACCAAGCGTAGACAAGTAAAAGAGTCTTCAGCTAATTG
AAAACACTGTATAGCCACAGATACCCATGCATAACATTGCACATAAATGAGCAAAGTTCGATGTGAATATAAAAGGTTGACGTTCATATTTCAGCTTGGAGGACCTTCATGGGAAGTACA
ACTTGGAAGGAGGGACTCGACCAGGGCGAGTAGGACAACGGCCAACACCGACATTCCCGCGCCAAACATGGACTTGCCTTCACTGATCAGCACGTTCCAAAAGCAGGGTCTCGACACACG
GGACTTGGTCGCACTGAGCGGTGCACACACAATTGGGTTCGCGCAATGTCGCGTTTTCAGGAACCGCACATACAACGATGCCAACATCGCCGCCGATTTCGCTGGGAGCCTCCGGTCCTT
GTGCCCGCGTACTGGAGAGGATAGCAACCTCGCTGGTTTGGATCCTTCGCCGGCTCAATTCGACGCATTGTACTTCCACAATCTGTTGGCGCAAAAGGGGCTTCTTCACTCTGATCAGGC
GCTTTACAGTGGTGGGTCAACGGATGAGCTTGTGAAAACTTACAGCGATGATGCGGAGGCCTTTTGGGATGATTTTGCGAAGTCGATGATCAAGATGGGAAACATAAAGCCGTTGATTGG
AAACCAGGGCCAGATTCGCTTGAATTGCCGGAAGGTGAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTTAGTAGCCTCAACTTCTTCCGAGCACTGCTCTTATTGTTCCTAGCGACGTCGGCTTTCTCGACGCGCCCTTACAAGGAAGGCCTCACGCCGCACTTCTACGACTACGCTTGT
CCTCAAGCTTTGCCTGCCGTCCAACGCATCGTGGAGGCAGCAGTGCAGCAGGAGCGACGCATGGGCGCTTCCTTACTGCGTTTGCACTTCCACGATTGTTTTGTTAAT
GGTTGCGATGCT
TCAATACTTTTGGATCCATCCCCTACCATTGACAGCGAAAAGCTCGCGTTTCCAAATAACAATTCAGCTAGAGGATTTGAAGTGATCGACCAAATTAAAGCAGAGGTGGACAAAGCTTGT
GGATACTCACTCGTATCTTGCGCAGACATCTTGGCCATCGCAGCTCGTGACTCTGTTGTTGCG
CTTGGAGGACCTTCATGGGAAGTACAACTTGGAAGGAGGGACTCGACCAGGGCGAGT
AGGACAACGGCCAACACCGACATTCCCGCGCCAAACATGGACTTGCCTTCACTGATCAGCACGTTCCAAAAGCAGGGTCTCGACACACGGGACTTGGTCGCACTGAGCGGTGCACACACA
ATTGGGTTCGCGCAATGTCGCGTTTTCAGGAACCGCACATACAACGATGCCAACATCGCCGCCGATTTCGCTGGGAGCCTCCGGTCCTTGTGCCCGCGTACTGGAGAGGATAGCAACCTC
GCTGGTTTGGATCCTTCGCCGGCTCAATTCGACGCATTGTACTTCCACAATCTGTTGGCGCAAAAGGGGCTTCTTCACTCTGATCAGGCGCTTTACAGTGGTGGGTCAACGGATGAGCTT
GTGAAAACTTACAGCGATGATGCGGAGGCCTTTTGGGATGATTTTGCGAAGTCGATGATCAAGATGGGAAACATAAAGCCGTTGATTGGAAACCAGGGCCAGATTCGCTTGAATTGCCGG
AAGGTGAACTGA

Retrieve as FASTA