Entry information : EgrPrx39
Entry ID 8154
Creation 2011-02-25 (Qiang Li)
Last sequence changes 2012-04-27 (Qiang Li)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2013-04-03 (Catherine Mathe)
Peroxidase information: EgrPrx39
Name EgrPrx39
Class Class III peroxidase    [Orthogroup: Prx041]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx39
start..stop
S start..stop
EguPrx39 665 0 1..323 1..323
EgrPrx33 657 0 1..323 1..323
EgrPrx36 655 0 1..323 1..323
EguPrx36 650 0 1..323 1..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 11253986..11254213 228 N° 2 11253692..11253886 195 N° 3 11252958..11253506 549  
complement(join(11252958..11253506,11253692..11253886,11253986..11254213))


exon

Literature and cross-references EgrPrx39
DNA ref. Phytozome 12:   scaffold_1 (11254213..11252958)
Protein sequence: EgrPrx39
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (300)
PWM (Da):   %s   35140.53 (32762.2)  
PI (pH):   %s   5.68 (5.68) Peptide Signal:   %s   cut: 24 range:24-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALNSLSLVQALLFLSLATSAFSTRPYKEGLTPYFYDYVCPQALPAIKRVVEAAVQQERRMGASLLRLHFHDCFVNGCDASILLDPTPTIDSEKFANPNNNSARGFEVIDQIKAEVDKACGYSLVSCADILAVAARDSVVALGGPSWEVQLGRRDSTMASRTTANSDIPAPNMDLPALINTFQKQGLDTRDLVALSGAHTIGFAQCFTFRNRTYNDDNIATSFARSLRSLCPRTGEDGNLAGLDPSPAQFDALYFHNLLAQKGLLHSDQALYSGGSTDELVKTYSDDAEAFWDDFAKSMIKMGNIKPLIGNQGQIRSNCRRLN*

Retrieve as FASTA  
Remarks Complete sequence from genomic. No prediction from Phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTAAATAGCCTCAGCCTCGTCCAAGCACTTCTCTTCTTGTCTCTCGCGACCTCGGCTTTCTCGACGCGGCCCTATAAGGAAGGCCTCACGCCATACTTCTACGACTACGTTTGC
CCTCAAGCCTTGCCCGCCATCAAACGCGTTGTCGAGGCGGCGGTGCAACAGGAGCGACGCATGGGCGCTTCCTTACTCCGTTTGCACTTCCACGATTGTTTCGTTAAC
GTACGACACATT
CACGATAATCTTATATTCGCATTGGTTATCTAGGAGCCGGCATAAATTTGCTCACTTGATTCTTGTTTTATCCACGTCATAATGTAGGGTTGCGATGCTTCAATACTTTTGGATCCGACC
CCTACCATTGACAGCGAAAAGTTCGCGAACCCGAATAACAATTCGGCTAGAGGGTTCGAAGTGATCGATCAAATTAAGGCGGAGGTCGACAAAGCTTGCGGATACTCACTTGTATCATGT
GCCGACATCTTGGCCGTCGCAGCCCGTGACTCGGTAGTTGCG
GTATGTCTTATCTTAATGCTACATATGATGCCTTCATTTAAGCAAAACTACAGTGCAGACAAATAGAAGAGAGAGTCT
CCCGCTAATTGAACACGCTAGGCGTAGAATCATATGCACATACATAATCTTTCGATTATCTAAGCAAAGCTGAATTTGAACTTAAAAGGTTGACTGAAATATTTCAGCTGGGAGGGCCTT
CATGGGAAGTACAACTTGGAAGGAGGGACTCGACCATGGCGAGCAGGACAACCGCCAACTCCGACATTCCCGCGCCGAACATGGACTTGCCTGCACTGATCAACACGTTCCAAAAGCAAG
GTCTCGACACTCGGGACTTGGTCGCGCTGAGCGGTGCTCACACAATCGGGTTCGCTCAATGTTTCACTTTCAGAAACCGCACATACAACGACGACAACATCGCCACCAGTTTTGCCAGGA
GCCTCCGGTCTTTGTGCCCGCGTACTGGAGAGGACGGGAACCTCGCTGGTTTGGATCCTTCGCCGGCTCAATTCGATGCATTGTACTTCCATAATCTGCTGGCGCAGAAGGGGCTTCTTC
ACTCTGATCAGGCGCTTTACAGTGGTGGGTCAACGGATGAGCTGGTGAAAACTTACAGTGATGATGCGGAGGCCTTTTGGGATGATTTTGCAAAGTCGATGATCAAGATGGGAAACATAA
AGCCGTTGATCGGAAACCAGGGCCAGATTCGCTCAAATTGCCGAAGGTTGAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTAAATAGCCTCAGCCTCGTCCAAGCACTTCTCTTCTTGTCTCTCGCGACCTCGGCTTTCTCGACGCGGCCCTATAAGGAAGGCCTCACGCCATACTTCTACGACTACGTTTGC
CCTCAAGCCTTGCCCGCCATCAAACGCGTTGTCGAGGCGGCGGTGCAACAGGAGCGACGCATGGGCGCTTCCTTACTCCGTTTGCACTTCCACGATTGTTTCGTTAAC
GGTTGCGATGCT
TCAATACTTTTGGATCCGACCCCTACCATTGACAGCGAAAAGTTCGCGAACCCGAATAACAATTCGGCTAGAGGGTTCGAAGTGATCGATCAAATTAAGGCGGAGGTCGACAAAGCTTGC
GGATACTCACTTGTATCATGTGCCGACATCTTGGCCGTCGCAGCCCGTGACTCGGTAGTTGCG
CTGGGAGGGCCTTCATGGGAAGTACAACTTGGAAGGAGGGACTCGACCATGGCGAGC
AGGACAACCGCCAACTCCGACATTCCCGCGCCGAACATGGACTTGCCTGCACTGATCAACACGTTCCAAAAGCAAGGTCTCGACACTCGGGACTTGGTCGCGCTGAGCGGTGCTCACACA
ATCGGGTTCGCTCAATGTTTCACTTTCAGAAACCGCACATACAACGACGACAACATCGCCACCAGTTTTGCCAGGAGCCTCCGGTCTTTGTGCCCGCGTACTGGAGAGGACGGGAACCTC
GCTGGTTTGGATCCTTCGCCGGCTCAATTCGATGCATTGTACTTCCATAATCTGCTGGCGCAGAAGGGGCTTCTTCACTCTGATCAGGCGCTTTACAGTGGTGGGTCAACGGATGAGCTG
GTGAAAACTTACAGTGATGATGCGGAGGCCTTTTGGGATGATTTTGCAAAGTCGATGATCAAGATGGGAAACATAAAGCCGTTGATCGGAAACCAGGGCCAGATTCGCTCAAATTGCCGA
AGGTTGAACTGA

Retrieve as FASTA