Entry information : EgrPrx144
Entry ID 8157
Creation 2011-02-25 (Qiang Li)
Last sequence changes 2011-02-28 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2013-04-03 (Catherine Mathe)
Peroxidase information: EgrPrx144
Name EgrPrx144
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx144
start..stop
S start..stop
EguPrx144 635 0 1..325 1..325
EcamPrx144 611 0 20..325 1..306
RcPrx36 511 0 15..325 16..326
PtPrx111 504 0 15..325 7..316
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 38231498..38231920 423 N° 2 38231208..38231373 166 N° 3 38230678..38231066 389  
complement(join(38230678..38231066,38231208..38231373,38231498..38231920))


exon

Literature and cross-references EgrPrx144
DNA ref. Phytozome 11:   scaffold_9 (38231920..38230678)
Protein sequence: EgrPrx144
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (295)
PWM (Da):   %s   34627.19 (31309.6)  
PI (pH):   %s   8.41 (8.20) Peptide Signal:   %s   cut: 31 range:31-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASTPGATAYSRRFAIFSSMLVLLCMSCHAQLSSTFYDESCPNALAAIRTSIRTAVSRERRMAASLIRLHFHDCFVQGCDASILLENSPTISSERDAGPNRGSVRGYEVIDDAKSEVEKICPGVVSCADIVAVAARDASVAVGSPSWTVKLGRRDSTTASPSLASSDLPSFQDGLERLVSRFAGKGLSARDMVALSGAHTLGQAQCFTFRDRIYSNGSNIDTGFASTRKRRCPASGGDATLAPLDLVTPNSFDNNYFKNLMQKKGLLESDQVLFSGGSTDSIVSDYSKKPASFKSDFAAAMIKMGDISPLTGSSGQIRRICSALN*

Retrieve as FASTA  
Remarks Complete sequence from genomic. No prediction from Phytozome. No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCAACCCCTGGCGCTACTGCGTACTCCCGTCGCTTCGCGATATTTTCTTCGATGCTAGTGCTCTTGTGCATGTCCTGCCATGCGCAGCTTTCCTCCACGTTTTACGATGAGTCA
TGCCCCAATGCCCTCGCCGCAATTCGGACTTCCATCAGAACCGCAGTCTCGAGGGAGCGCCGGATGGCTGCTTCTCTCATCCGACTCCATTTCCACGATTGCTTCGTCCAGGGTTGTGAC
GCGTCGATACTGCTGGAGAATAGCCCCACCATCTCTAGCGAGAGAGACGCAGGGCCGAATAGAGGTTCCGTGAGAGGTTATGAGGTGATTGACGACGCCAAGTCGGAAGTGGAGAAGATC
TGTCCAGGAGTCGTGTCTTGCGCGGATATTGTTGCCGTTGCAGCTCGAGATGCTTCTGTTGCC
GTAAGTCTTCCCATAGTTCTCAAAATATGCATCTTATGATCACTTGATTACTTTCAA
ATATCGACTACGAGTCTAAATCATTTTCCTTACTGATATAACTGATGCTGCTGTGACAAAAATGTAGGTTGGCAGTCCTTCTTGGACGGTGAAGCTCGGAAGAAGAGACTCGACCACCGC
AAGCCCATCTCTCGCGTCAAGCGATCTTCCATCGTTTCAAGATGGCCTTGAGAGACTCGTATCTCGATTTGCAGGCAAGGGCCTTAGTGCTAGAGACATGGTTGCCCTCTCAG
GTATATA
CGAAATGCTTATTCAAACCTGACGATGGAGCTTGGCCTATGCAAGAATTTCTCATTCTTGCTCACAAGCTCGAATGATATTGAATAAAAGGGAAAAATAATGTTGATGTGACCTTTTCTA
CCAACGTTATGCAGGTGCTCACACTCTAGGGCAAGCTCAGTGCTTCACGTTCAGGGACAGGATCTACAGCAACGGCAGCAACATCGACACGGGATTCGCCAGCACCCGTAAGCGCCGGTG
CCCGGCAAGCGGCGGCGATGCCACTCTAGCCCCACTGGATTTGGTGACCCCCAATTCATTCGACAACAACTACTTCAAGAATCTGATGCAGAAGAAAGGCCTACTCGAGTCGGACCAAGT
CCTTTTCAGCGGAGGTTCCACCGACAGCATCGTCTCCGATTACAGCAAGAAGCCCGCAAGCTTCAAGTCGGATTTCGCGGCTGCCATGATTAAGATGGGCGACATAAGTCCGCTCACCGG
TTCAAGTGGCCAGATCAGGAGGATTTGCAGTGCTCTAAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCAACCCCTGGCGCTACTGCGTACTCCCGTCGCTTCGCGATATTTTCTTCGATGCTAGTGCTCTTGTGCATGTCCTGCCATGCGCAGCTTTCCTCCACGTTTTACGATGAGTCA
TGCCCCAATGCCCTCGCCGCAATTCGGACTTCCATCAGAACCGCAGTCTCGAGGGAGCGCCGGATGGCTGCTTCTCTCATCCGACTCCATTTCCACGATTGCTTCGTCCAGGGTTGTGAC
GCGTCGATACTGCTGGAGAATAGCCCCACCATCTCTAGCGAGAGAGACGCAGGGCCGAATAGAGGTTCCGTGAGAGGTTATGAGGTGATTGACGACGCCAAGTCGGAAGTGGAGAAGATC
TGTCCAGGAGTCGTGTCTTGCGCGGATATTGTTGCCGTTGCAGCTCGAGATGCTTCTGTTGCC
GTTGGCAGTCCTTCTTGGACGGTGAAGCTCGGAAGAAGAGACTCGACCACCGCAAGC
CCATCTCTCGCGTCAAGCGATCTTCCATCGTTTCAAGATGGCCTTGAGAGACTCGTATCTCGATTTGCAGGCAAGGGCCTTAGTGCTAGAGACATGGTTGCCCTCTCAG
GTGCTCACACT
CTAGGGCAAGCTCAGTGCTTCACGTTCAGGGACAGGATCTACAGCAACGGCAGCAACATCGACACGGGATTCGCCAGCACCCGTAAGCGCCGGTGCCCGGCAAGCGGCGGCGATGCCACT
CTAGCCCCACTGGATTTGGTGACCCCCAATTCATTCGACAACAACTACTTCAAGAATCTGATGCAGAAGAAAGGCCTACTCGAGTCGGACCAAGTCCTTTTCAGCGGAGGTTCCACCGAC
AGCATCGTCTCCGATTACAGCAAGAAGCCCGCAAGCTTCAAGTCGGATTTCGCGGCTGCCATGATTAAGATGGGCGACATAAGTCCGCTCACCGGTTCAAGTGGCCAGATCAGGAGGATT
TGCAGTGCTCTAAATTAA

Retrieve as FASTA