Entry information : SbPrx47 (Sobic.002G416700.1 [2.1] / SB02G042860 [1.4])
Entry ID 816
Creation 2005-12-30 (Christophe Dunand)
Last sequence changes 2005-12-30 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbPrx47 (Sobic.002G416700.1 [2.1] / SB02G042860 [1.4])
Name (synonym) SbPrx47 (Sobic.002G416700.1 [2.1] / SB02G042860 [1.4])
Class Class III peroxidase    [Orthogroup: Prx115]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue types Leaves
Roots
Seedlings
Inducers Acid treatment
Alkaline treatment
Colletotrichum inoculation
Light growth
Pathogen interaction
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx47
start..stop
S start..stop
ZmPrx42 469 3e-168 23..313 30..321
ZmPrx07 462 6e-166 27..312 34..320
ZmPrx66 457 7e-164 27..312 34..320
ZmPrx114 454 1e-162 1..311 1..313
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 76598554..76598760 207 N° 2 76598982..76599164 183 N° 3 76599263..76599425 163 N° 4 76599545..76599933 389
join(76598554..76598760,76598982..76599164,76599263..76599425,76599545..76599933 )


exon

Literature and cross-references SbPrx47 (Sobic.002G416700.1 [2.1] / SB02G042860 [1.4])
Literature Cordonnier-Pratt,M.-M. et al., unpublished
DNA ref. Phytozome 11:   chromosome_2 (76598554..76599933)
Protein sequence: SbPrx47 (Sobic.002G416700.1 [2.1] / SB02G042860 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   313 (291)
PWM (Da):   %s   32304.49 (30341.5)  
PI (pH):   %s   4.35 (4.35) Peptide Signal:   %s   cut: 23 range:23-313
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAASASCLAFLVAAAVASVASAQLSSTFYDTSCPNALSTIKSGVDAAVMQEARTGASLLRMHFHDCFVHGCDGSVLLNDTSGEQSSPPNKGSLRRFDVIDSIKAQVEAVCPGVVSCADILAVAARDSVVALGGPSWTVLLGRRDSTASFPSETTDLPAPTSSLQQLLSLFSNKNLDATDMVALSGAHTIGQAQCSNFNDHIYNDTNIDAAFATSLQANCPASGSTSLAPLDTMTPTTFDNDYYTNLMSQKGLLHSDQELFNNGSTDSTVSNFASSASAFTSAFTAAMVKMGNLSPLTGTDGEIRLACGIVNSS

Retrieve as FASTA  
Remarks Complete sequence genomic (chromo 2, 3 introns) and 17 ESTs + CB925952 (singleton with frame shift).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCCTCTGCTTCTTGCCTCGCCTTTTTGGTGGCGGCGGCGGTGGCCTCGGTGGCGTCGGCGCAGCTGTCGTCGACGTTCTACGACACGTCGTGCCCGAACGCGCTGTCCACCATC
AAGAGCGGCGTGGACGCGGCGGTGATGCAGGAGGCGCGCACCGGGGCGTCGCTGCTCCGGATGCACTTCCACGACTGCTTTGTGCAT
GCAAGTCTCTACCTCCCACATGCATAAAGACGA
CACTAGCTGGCTCATCTATCTTTTCTTCGTCTGTTTTTTTTCTGACATATAATTCGATCAGATACATATTATCCAAATTAAAGTTTGTTTACATATACGCCGTAGTACGTTGACAGGACA
GCACAGTGTGTGTGCGTACGTGTGCCACACTAGCTAGCTAACTAGAAATTTGTAAAACCTCGCTCCAGGGCTGCGATGGGTCCGTTCTACTGAACGACACGTCTGGGGAGCAGAGCTCAC
CTCCAAACAAGGGATCGCTGAGGCGCTTCGATGTCATCGACAGCATCAAGGCGCAGGTGGAGGCCGTCTGCCCTGGGGTCGTCTCCTGCGCCGACATCCTCGCCGTCGCCGCCCGAGACT
CCGTCGTCGCG
GTGAGATAGTTCCAATCTAGCTAGTTCCAGGCAACTAGCCACCCTGTTTCCCCTGTTGCTGACTTGCTGTCAATTATTGGTCTGGAACTCCTGCCCAGCTCGGCGGGCC
TTCGTGGACCGTTCTACTGGGGAGAAGGGATTCCACCGCTTCATTCCCGAGCGAGACAACCGACCTCCCAGCTCCAACATCTAGCCTCCAACAGCTGTTATCTCTGTTCAGCAACAAGAA
CCTCGACGCAACAGACATGGTTGCTCTCTCAG
GTGCATATGCATATGCATGCAATCCCTAGGCCTAGCTAGAATACATATATAGATATATACCTTTGAATCTTTGGTCGTTTCTTTCAGT
CTGACGACGACGCACGCATTGCATTTTGCAGGGGCTCACACTATCGGACAGGCGCAGTGCTCCAACTTCAATGACCATATCTACAACGACACCAACATCGACGCCGCCTTCGCGACATCG
CTGCAGGCCAACTGCCCTGCATCAGGCAGCACCAGCCTAGCGCCGCTGGACACCATGACCCCCACCACATTCGACAACGACTATTACACCAACTTGATGTCGCAGAAGGGGCTCCTGCAC
TCGGACCAGGAGCTCTTCAACAATGGCAGCACCGACAGCACGGTCAGCAACTTCGCGTCCAGCGCATCGGCCTTCACCAGCGCCTTCACGGCGGCGATGGTGAAGATGGGAAACCTCAGC
CCACTCACCGGAACTGATGGGGAGATCAGGCTCGCCTGCGGGATCGTCAACTCCTCCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCCTCTGCTTCTTGCCTCGCCTTTTTGGTGGCGGCGGCGGTGGCCTCGGTGGCGTCGGCGCAGCTGTCGTCGACGTTCTACGACACGTCGTGCCCGAACGCGCTGTCCACCATC
AAGAGCGGCGTGGACGCGGCGGTGATGCAGGAGGCGCGCACCGGGGCGTCGCTGCTCCGGATGCACTTCCACGACTGCTTTGTGCAT
GGCTGCGATGGGTCCGTTCTACTGAACGACACG
TCTGGGGAGCAGAGCTCACCTCCAAACAAGGGATCGCTGAGGCGCTTCGATGTCATCGACAGCATCAAGGCGCAGGTGGAGGCCGTCTGCCCTGGGGTCGTCTCCTGCGCCGACATCCTC
GCCGTCGCCGCCCGAGACTCCGTCGTCGCG
CTCGGCGGGCCTTCGTGGACCGTTCTACTGGGGAGAAGGGATTCCACCGCTTCATTCCCGAGCGAGACAACCGACCTCCCAGCTCCAACA
TCTAGCCTCCAACAGCTGTTATCTCTGTTCAGCAACAAGAACCTCGACGCAACAGACATGGTTGCTCTCTCAG
GGGCTCACACTATCGGACAGGCGCAGTGCTCCAACTTCAATGACCAT
ATCTACAACGACACCAACATCGACGCCGCCTTCGCGACATCGCTGCAGGCCAACTGCCCTGCATCAGGCAGCACCAGCCTAGCGCCGCTGGACACCATGACCCCCACCACATTCGACAAC
GACTATTACACCAACTTGATGTCGCAGAAGGGGCTCCTGCACTCGGACCAGGAGCTCTTCAACAATGGCAGCACCGACAGCACGGTCAGCAACTTCGCGTCCAGCGCATCGGCCTTCACC
AGCGCCTTCACGGCGGCGATGGTGAAGATGGGAAACCTCAGCCCACTCACCGGAACTGATGGGGAGATCAGGCTCGCCTGCGGGATCGTCAACTCCTCCTAA

Retrieve as FASTA