Entry information : EgrPrx28
Entry ID 8160
Creation 2011-03-01 (Christophe Dunand)
Last sequence changes 2012-02-16 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-24 (Qiang Li)
Peroxidase information: EgrPrx28
Name EgrPrx28
Class Class III peroxidase    [Orthogroup: Prx041]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx28
start..stop
S start..stop
EguPrx31 600 0 19..324 19..323
EgrPrx31 600 0 19..324 19..323
EcamPrx31 598 0 1..324 1..323
EglPrx31 597 0 19..324 19..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 11091734..11091961 228 N° 2 11092060..11092257 198 N° 3 11102337..11102880 544  
join(11091734..11091961,11092060..11092257,11102337..11102880)


exon

Literature and cross-references EgrPrx28
DNA ref. Phytozome 12:   scaffold_1 (11091734..11102880)
Protein sequence: EgrPrx28
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   324 (301)
PWM (Da):   %s   35100.52 (32558.1)  
PI (pH):   %s   5.34 (5.13) Peptide Signal:   %s   cut: 24 range:24-324
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVLSSLNFFRALLLLFLATSAFSTRPYKEGLTPHFYDYACPQALPAVQRIVEAAVQQEQRMGASLLRLHFHDCFVNGCDASILLDPSPTIDSEKLAFPNNNSAIGFEVIDQIKAKVDKACGYSLVSCADILDIAAHDSVVAVLGGPSWEVRLGRRDSTRASRTTANTDIPAPNMDLPSLISTFQKQGLDTRDLVALSGAHTIGFAQCRVFRNRTYNDDNIAADFAGSLQSLCPRTGEDSNLAGLDPSPAQFDALYFHNLLAQKGLLHSDQALYSSGSTDELVKTYSDDVEAFWDDFAKSMIKMGNIKxxIGNQGQIRLNCRMVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, introns 1 and 2, Very long intron). No prediction from phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTTTGAGTAGCCTCAACTTCTTCCGAGCACTGCTCTTATTGTTCCTAGCGACGTCGGCTTTCTCGACGCGCCCTTACAAGGAAGGCCTCACGCCGCACTTCTACGACTACGCTTGT
CCTCAAGCTTTGCCTGCCGTCCAACGCATCGTGGAGGCAGCAGTGCAGCAGGAGCAACGCATGGGCGCTTCCTTACTGCGTTTGCACTTCCACGATTGTTTTGTTAAT
GTACGACATGTC
CACAATACTCTTAAGTTCGCACTGGTTATTTAGCGGCGCTCTCACATGTCCTAATTTGATTTGTTTCCATTTATGCAATAATGTAGGGTTGCGATGCTTCAATACTTTTGGATCCATCCC
CTACCATTGACAGCGAAAAGCTCGCGTTTCCAAATAATAATTCAGCTATAGGGTTTGAAGTGATCGACCAAATTAAAGCAAAGGTGGACAAAGCTTGTGGATACTCACTCGTATCTTGCG
CCGACATCCTGGACATCGCAGCTCATGACTCTGTTGTTGCGGTA
CATCTAATCTTAATCTCACATATAACGTGGGTCATTTTTACCAAGCACAGACAAGAAACAGAGTCTTAAGCTAATT
GAACACACTTGTCGCGACCTACCCTCGGGGGGAGGGAACAAGTTTAGGGGTATTGCCTAGAGGACGAGCCTAAGGCCCATGATTAGGCATGGGCTCTCCCAAGCCCATACCCCACGTGAC
ATTTGGATATTTTCTAGGAAGTTTTGCACAAAAGGAGTCGCCATTAGCCTATTGGGGTCAACTAGAAAGCAAGTGAGGCATGGGAGCGTGCCTCACTTCCTACGCAACCAGAGAATCTAG
GGTTGGGGACTTGATTACACTAATTAACCAATTAGTGCCATTTCGGTACCTAATCTTGTTCATTTTAATAAAATGATTTTTGTCAAGCAGTTTGGATTGATTTTATGTTTATCCACTAAT
ATGTGAGGTAATCATGCAAGTGCACAATCATTAAAGTAAATCATAGCTACCAAGATCCTAATTGCAGTAAAATTAACACATACCACTAAGCAATTGCAAACATAGTTAAACGGATAATTT
AAACATGCAATACAATCAATATACGAGTAATTAAAGACCTAAATACATTATAAATGCAATACACAGTCATTCCTAATCAAAACCCACATTTTTTGGATTTTTGAAAATTTTTAAAATATT
TAAAAAAATAATAATTTTTTATTTAAAATAAAAAGGCGAACCGGGTCGGGTCCGGTCTCCGATCGGACCCGGGTTCGATCCGGTTGGCAAGCGGGCCAGTTGGCTCGCTCGAAAAAGGGC
CAAGCGAAAACCTAGCCGAGTTAGGCCTAATGTGTAGGCCCAGTCCGATCTAATAACTTTTTTTTTTTTTTAAAGAAAGAAAGACCATAAGTCTATAAGCCCACAAACTCACAAGCCACA
AGCCCACATGCAAAAACAAACCAAATCAGGCCCAAAACACCCAAAACTCTACCCGGTTGATTGGACTCCGCCCGATCACGCGACCTGGATTCTGGGGCCATAAAGCTCGGTGACCCGCGG
CGCCGAAGGGGTTGGCTGGGACTTTGACAGCGGTGACGCGGCAGACGGCTGACTCGAGTGGGGCAGCGGTGGTGCGAGGCGGCTTGGACGGCGTCGAACAAGAGGGGTTTGGCTGAAGGA
TGGCGTCTGGTGGTGAAACAGCAGCGGCATGCGACGGTGGGGGAAGCACTACGACGATGGTTGACAGTGGAGGGAAGCAGCACAGCAGTGGTCAACGGCAGTGCCGAAGTCCCCTCTTCT
CCTCCTCCGCTCCTTCCTGATCTCTGTTTTCTTCGTCTTCTGTTCTTATTCTTTCTTCGTCTACTTCAGATTTGGGTTCCGGGGAAACGAGCGGCGGCTGGTGTGATCGGTGGCGGTACG
GCTTGAGGGAGCGACATGGGCGAGGGGGGGGGGGGCTCGGAGCGGCATTGTCCAGCAGAGGAGGGTTCTGGCTGTTGGCACGGTGGTCGTCACGGCTGCAAGTGCTGCAGCGGTGTCACG
GCTTTGAGTTGCTGGCGATCGCTATGACGTCTGCGACGGAGTTGGTTGCAAAAGCAGCGGCGGTGGCGGCGGCGACAACGGCGAGGGGACTAGTAGCGGCGAGCGACAGCGGGCTAGGAG
CGGCGGTTCGGACGGCGTCGGGTTGAGGCGGCGAGGTCTCCCTCCTCGGATCCTCCCCTTGACACCGATCTCTCTCTCTCTTCTGGTCTCTCTCGAGCTCTCTCTCTTTCTCCTCTCTTG
AGCTCTCTTTGTGTTCCCCTCTCCCTCTCTGTCTTGCTCTCTCACTACTCTCTTTGGTTGCTTTCTAGGGTTTTTCCTTTTGTTGATGTGTTTCCGTTCAAACTCCTCTGTCCAGCCCCC
TGTCTCTACTAGGGTTTTTTTTGGTTTTGACAGCTGAAGGAAAAGAAGAGACAAGCATGATCCAGGCCAAAAAAGAAATGGGTCGGGCGCGCGCGACAGAGAGGAAAAATGGAGGGCCGA
GTTGGGCCCAGGCCAAATTCAGCTCGACCCGGCCCCTCTCGCGTCCTCTTTTGTGTTTTTCTTTTGTTGTCTTTTGTTGTTTTTTTTTGTTTTTTTTTGTTTTCTTTTTTTTTAGCGACT
AATTCCTAATTTGTATGTGATTAAGTTTTAAATAAAATTGTAAAATTTAGGTGTCAACAGCTGCCCCTCTTTGAATGGGAGCTCGAAGAGGTTCCATTCAAAGATAAAAGACACCTAAAT
TATTTTGGTGATAGAGAGACCCTAGGTGCATAGGCACGTATCAGGTCGATGATCAACTCATAATTATGTAAGCGCGTTTTGTCAATAAGAGGAAGAGAGACCCAGGGCTACAGAAGCACG
CCGTGTCATAAGAAGAATGACTCCGGGCTACAAAGCTCTCTGGGTTACAAAAGCTCTCCGGGCTACAAACACACTGTGTCATAGGAAGAAGGACTCCGGGCTACAAAGCTCTCTGGGCTA
CAAAAGCTCTTTGGGCTACAAAGCATACCATGTCATAGGAAGATGGACTCCAGGCTACAAAGCTCTCCAGGCTACAAAGCACACTGTGTCATAGGAAGAAGGACTTCGGGCTACAAAGCT
CTCTGGGCTACAAAGCACACCGTGTCATAAGAAGAAGGACTCCGGGCTACAAAAGCTCTCCGGGCTACAAAGCACACCGTGTCATAAGAAAGACTCCGGGCTACAAAGCTCTCCGGGCTA
CAAAGCACACCGTGTCATAGGAAGAAGGACTCCGGGCTACAAAGCTCTTCAGGCTATAAAGCACACCATGTCATAGGAAAAAGGACTCCAGGCTACAAAGCTCTCCAAGTCATAAGAAGG
GGGTTAAAGGACTCCGGGTTACGGAAAGCCCACCAGGTCATAGAAGGGGGTTGAAGGACTCCGGGCTATGAAAAGCCCATGGGGTCATAAGAAGGGGGTTGAAAGACTCTGGGCTACGGA
AAGCCCACCGGGTCATAAGAAGGGGGTTGAAGGACTCCGGGCTACGGAAAGCCCACTGGATCATAAGAAGGAGGTTAAATGAGGTCTCACCGTGTAACAACGGGTTTCGACCGGGTATGA
TAGTCTCACCGTGTATGAACGGGTTTCGACTAGGATGAAGGTCTCACCGTGTACGAATGGGTTTCGACTTGGTATGATAGTCTCACCATGTACGAACGGGTTTCAACTAGGATGAAAGTG
TCCCCGTATACGAACGGGTTTCGACGGGGTATGATAGTCTCACCATGTACGAATGGGTTTCGACTGGGATGAAGGTCTCACCGTGTACAAATAGGTTTCGACCGAATGGAAAATGCATGA
TTTAAGGAAAACCAATGAACCTTTGTAGATGATATGGTTTAAAGTTGACCATGAACCTTTTGAAAATCGCAGTTTAAAGATAGACTCATGAGAATTTTAAAAGTGTGGTTTAAGGATAGA
CCCACGAACTATGTGGTTTAGGAAAAGCCACCAACCTCGTGGTTTCGGGATAAATCCACCAATCTTGGAAATGGCATGGTTTAAGGCTAACCATGAACCCTTAGTTTTTAGGGAAGCACT
CGCTAACTCCTTGAAAACCGCATGGCTTCACTGAGGAATTCTGTCAAACTCAACTTGAGCAAATTTCATTAAAGGCGTCATCAAGAGACGTATTGGCAATATTACAGCATTAATTAAACA
AGCTAATCAAGCTAAGTCCGACCGCTTTAGAAAAATATTCAATGCCAATCAGCATCATGTGGCACAAAATTGTCATATTGCTTGAGGATATATCATTAATCATAAGATTCTCCAAGAGTC
AACTTCTTATCAAAACGACTACAACTCGTGAATAAGGCTCATTAATCATGCCAAACTAGAGCTTCTTAGTCAGAAAGGGTTTCTCACATACTCTTAATAAAATGGTTGCTTGATCCCATC
CATTTACATGGGGAGTAGCTGATTGCTGAGAGTATCTCACATAACCCATGTCAAAGGCTTTTAGAAACATTCACTATAAGCACAATTTGATCGATAAAAAAGGTCTTTTGAAAGGATCGC
AATATAGGCTCGATTAGGGCTTACACAAAGGAATTATTTCTTTGAGGTCAATAAAGGAACATTTATCGCTATATTCATTGGGTTTACAAGTTGAGAACTTGGAAGATAAGACAAGATAGA
ATTACTTCCACTCCTTCAAGCAATAACTTCTTTGTGGTATTCTCATTTTCACTCAAACCGTCCCAATCAGAAGAGACTTCGGAAGAGGGTTGTAATGTTGGCTTGGGAGAGGCTTGAAAG
GCTTAAGATTTTCGAGAGGATTTTTAAGAGTTGGTGATCATCATGGCATCGCGACCAAGTCACTTGATCTTTCGAAGGCATTTGGCTTTCGAAACACTGCGCATCTCGAAAGTCTCTTGA
CTAATCATTTCTACATGGGAGTTTTGCTCCTTTTTTTAATTTCCTTTGCCCTTTGTGATTATGATTTTTTTTTCGTAGGCACTTGGATTTTGATAATTTTTCTTTCACATAAGATTTAAC
TTTTTGCCTTTTTTTTTTTTTTTTTTTTACGGGTATTGGCCTTCCTTTTACCAGGCACACTACTTTTTCATGCCCCATAATTTGTCAAACTTTTTGCTTTTTGAATTTTTGTAGCTCTTA
TGACTTTCGAGACGCTTTTCTCATTTTCTCGTGACTGTCAATTATATTTGGTTAATTCTTATGCCTTGCCCCAATGAAGGGAGATAATCACCGTTCGCGATTAAGAAATGAATAATCAGG
CCAAAATTGGTTAAAGCAATGGGTATCAGTGTTTGGGTAGAGAATGAAATGTTCTTCTTCACCTTGGGATGAGTCAAGCTCTAATGAGAATTCCTTTGAAGTTATCATTAGAAGATTGAT
GCAAGTGAAAGTAATAGAATCTTTCTCAATCTTTCGATCTACAACATGATCATAACCCCCTATGTTACCCCAATGTAGGGTTGTTCTTGACAATGGTACTTTGAAGTATCATTTTTTTTC
GGCCCAAAGGGATAGCAAGAGATTAGTGCAATGCTTGGGATTGATGAAGGAAACGCCTTTATCATTTCGATTTTTGCGCTCAATGCGAATGAATCCTTCGTCCTAAGAGAAGGTCGTTTT
TCACTCAACTCTCAAAAGTGTTTGAAGGACACTCAACTCTCAGAAGTGTTTGAAGGACGTGTTTGGAAATGACTTACCTTTCTTCATCCTGAGAACTTCTTGTTTGGCATGGTTAATGTC
TCCTTCTCACTCTGTTGAGATCATTTGAGTAGATCAATCTCCATAGGGAAATTTTATTCAAAATGAATAATCCACAAAACGATAAAACAATTTTGAGATAAAAAGGATGCTAAAAAAGTT
TGTGGAATTTTTTTTCTCAATTATTCATTTTTTTTCATCTCTAGAAAAGTGCCAAATGTTCTATTTTGTGATGGAAATTCTCTTTTTTTTTTCCCTGTAAAGAATGTGAAAGAATATGTT
AGTGCAAACATCTTTAGGGATTGAAATATTGGAAACGATACAGTATTACCCTTCATTTGCTTTCATCATTTGAGCGCTAACATCTCTTGGGTTCACCTTCATGGATATTTAGTAACTCGG
CAATACCCTTCCCTTGTATTCACCTTTAAGTGTTTGACGTTTTCTTGATTCCTTGGTAGAAGGCGCCGCTTCTACGGTCAAGATGCAACCTTTTTTATCACCCTGTAAGAAGGGAAGATG
AAACGAGTTTTCTCCATTCTTAGTTAGGTTCAACTGAGGAACGATACATCCTTTTTGATGAATTTGACAATGTTGTTCCAGCACACTTCATTGGTGGGTGAAGGAGAGATTTTTCTCCAA
ATCGAACATTGTTCTCCCACTCTTTATATGATAAACATTTGTTCTGTTCGAGTCTGTCTCGTACCAAAGAAAAGGACATGTCATTTTTTATGCTGAAGAGAATCAAATTTAAGAACGAGA
TACATCCTTTTCAAAGTCGAGCGATCAACATCCTAAGATATCTCTCATGGAGAAATGAATAATATTGCCCCTCCGTTTCATTTGAATATTTCTCTGTTTAAGATGAACAAGACTCAATAA
TGCTCCATCGCATTTGTTGGAACATTACAAAACTAGGTACTCTTGATGTCTCCTTGGCAATGAAAAGAAAATTAAGTCAGAAACGGTATCGGAAATGGATAATTGGAAACGATACAGTTT
ACTCCTTTCATTTGTCTCATCATGCAAAGTGAACAAGATCGATGGATTGTTTTGGCATCTAAGCACTTGCGAATAACAAAACTTCCCAGAATGGAATTCAACTTCGTTCCGCCTCTATGA
AAAATTGGTGCCAAGGCATCCTCGGCGCATGCTTACTCCTCAAGTTCCATGAGCCTATACTTTTATCTTTTAGAATGAGCAAATGTCGATCTCAAATAAACTCATCATCCTACCGGAGAA
AGCGATTCCGTGAAAAGAGACCCTTAAGCAAAGCTTTCTTGAAATTCATTTTGGAAGGTAAATGTAAAGATTCACTTGAAACACTTACGAATTCATTTTTTTTAAGGGATGATTTTCATG
AAATTGAATTCCATCATAAAAAATGAATCGCATGATTTACAAAAGCAACAGTTGGATTCGCAATCAAAACTCTAAATGGAATTCACTTCTTTGTGTGGTCACCAAGAGAATGTCAAGGAG
CATTGCTCATAACCTGCAAAAAGACGACAATATTAGTATATGAATGAGAGAAAATGATATATCAATGAGATCGTTTCTTACAATAAAATCAAGGCGGCGGTACATGCCCCACAGTTCTCA
TTACAGGGTTTTGGTATTTCGCCAAGATTTTATCATAAGAGAAGACATCATTAAAATGATCAATTCACGGCCATCAATCGAATGTCCACTTTTATTCCAAAAGTTACGTATGCAAAAATG
TCATTGATTTTTGAAAGATTGATTTGTGATTTTACCCCTAGAAAAATGAAGTGACTTCTATTTTGAGAAATATGTACACAAAATGATTTGCATTTTAGTCCCAAATGTGAGAATGAGAAA
ATTTGATAAAAATGCAATTTCAATTTTGGCGCCCCAATATAAAACCACAACTTGAAAGTTTTTATTTATTTTTATTTTTTTTCAAAATGATTTTGAGCCCATAGCTAGAAATTTAAACAA
AACCATGTGTTCAACAGGGCCAAATCAAAGCGTTTAGAACTTGTATTCAATGTTCACTTATCAAAAGTGATTGCTAATTTTTTCAATTATAAGCCAATGGCACCAAGGACAATCGATTGA
TGTTCGCAAATTTCAAGATGGAAGCTCAATACAAAATGAGCAAATAACAAAGAAAATGATACTTACAATGGGTGCAAACCTTTGTCTTTTTTTTTTTTTTTTCAATTACATAGACATGCA
CATGGGATGTGGTTCGATTTCTATTCTAGACGGCCCAAAATGGAGTCATGGGATCACAAGACTGAACCAACAAGCTCGCGGCTAGGCTGTGTTACCCATGACTCCGGCTTTGTCAAAGGA
CCGACCCGTGTCGCATGCTCGCAGACTAGGGTGGGGACCTCTGACATAAAGAAATAAGTTTCGGGGATGAGATGAGTGACTCGTACTACATGCTTGTAGTCGGAGTGGTATCCATCACAA
CACCATCCTAAGTGATCCTATGTGGCCCAAGTCTAGCGGCAGGTAGTGTGTGCTATAGTGTAGTGCAATGCAGAGGACTCATGCATGACAATTTAAAAACAATCAGCACTTCAATCATAA
ATAAACCATTCATTCTTACACCCCTACAAAACAAAGGTTAGAAATCACCACCCCTTATAACTCCCATAAGCATTTAACATTTGACATATTATGGATGCATATGATATCTTCGCTGCCAAA
CAAATATATTTTTGAACAAGATTAATTTTGGCTTAAGTCCTCTAGGGTTTAAAACCATGTCCCCAGTAGAGCGCCAAGCTGTCGTAACCTACCCTCGGGGGGAGTGAACAAGTTTAGGGG
TATTGCCTAAAGGACGAACCTAATGCACATGATTAGGCACGGGCTCTCCCAAGCCCATATCCTGCGTGACATTTGGATATTTTCTAGGAATTTTGCACAAAAGGAGTTGCCACTAACCTA
TTGGGATCGGCTAGAAACCAAGTGAGGCATGAGAGCGTGCCTCACTTCTTACGCAACCAGAGAATCTAGGGTCGATGACTTGATTACACTAATTAACCAATTAGTGCCATTTTGTTACCT
AATCTTGTTCATTTTAACAAAATGATTTTTGTCAAGCAGTTTGGATTGATTTTATGTTTATCTACTAACATGTGAGGTGATCATGCGGGTGCACAATCATTAAAGTAAATCATAGCTACC
AAGATCCTAATTGCAATAAAATTAACACATACCACTAAGCAATTGCAAACATAGTTAAACAGATAAATTAAACATGCAATATAATCAATATACGAGCAATTAAAGACCTAAATACATTAT
AAATGCAATACATGGTCATTCCTAATCAAAACCTACATTTTTTGAATTTTCAATTTTTTTTTAATTTAAAAAAAAGGCGAATTGGGTCAGGTGAAAACCAAGCCGGGCTAGGCTTGATGT
GCAGGCCTAGTCCGGTCTAATAAGTTTTTTTTTTTTAAAAAAAAAGAAAGAAAGCCCATAAGTCTATAAGCCAACAAACTCACAAGCCACAAGTCCACATGCAAAAACAAACCAAATTAG
GCCCAAAACGCCCAAAACCCTACCCGGTTGATTGGACCAGGCCCGATTCACGGGACCCAGATTTTGGGGCCTTAGAGCTCATTGACCCGCGGCGCCAGAGAGGTTAGCTGGGACTTCGAT
AGCGGCGACGTGACGAACGACTGACTTGAGTGGGGCAGCGGTGGCGCAAGGTGGCTCGGATGGCATTGGACAGGAGGGGGTTCGGTCGAAGGATAGTGTCTAGTGGCGAAACGGCAGTGA
CAGGTGATGGTGGGGGAAGCAATACGGCGGTGGTCGACAGTGGAGGGAAGTAGCACGTCGGTGGTCGACAGTGGAGGGAAGAGCACGGCAATGGTTGATGGCGGTGCTGGAGTCCTCTCT
TTTCCTCCTCCGCTCCTCCCTGCTCTCTATTTTCTCCGTCTTCTATTCTCGTTCTTTCTTCGTGTACTTTAGATTTGGGTTCCGAGGAAACGAGCGGCGGCTAGTGTGATTGGTGGCGGT
ACGACTCAAGGGAGCGACACTGGCGAAGGTGGGGGGGGGGGGGGCTCGGAGCGGCGTTGTTCGGCGGAGGAGGGTTCTGGTTGCTGGTGCGATGGTCGTTGCGGCTGCAGGTGCTGCAGC
GGTGTCACGGCTTCGAGCTGCTGGCGATCGCTACGGCGTTAGCGGTGGAGTTGGTTGCAAAAGCAGCAGCGGCGGCTGCAAGGGGACTAGTAGCGGCGGGCGACAGCGGGCTAGGAGCGG
TGGCTCGGACGGCGCCGGGTTGAGGCGGCGAGGTCTCCCTCCCCGGATCCTCCCCTCGACGCCGATCTCTCTCTCTCTCTCTCTCTCTTCTGGTCTTCCTCGAGCTCTCTCTCTTTCTCC
TCTCTCGAGCTCTCTCTGTGTTCCCCTCTCCCTCTCTATCTTGCTCTCTCACTGCTCTCTTTGGTTGCTTTCCAGGGTTTTTCCTTTCGTTGATGTGTTTCCGTTCGAACTCCTTTGTCC
AGCCCACTGTCTCTGCTAGGGTTTTTTTTTGGTTTTGACGGCTAAAGGAAAAGAAGATACAAGCATAATCCGGGCCAAAAGAGAAATGGGCAGGGCGCGCGCAACAGAGAGGAAAAACGG
AGGGCCAGGTTGGGCCCAGGCCAAATTCGGCCCAACCCGGCCCTCTCTTGTCCTCTTTTGTGTTTTTCTTTTGTTGTCTTTTGTTGTCTTTTTTTTTTTTTTGTTTTCTTTTGTTTTCTT
TTTTTTAGCGACTAATTCCTAATTTATATGTGATTAAGTTTTAAATAAAATGGTAAAATTTAGGTGTCAACAACACTGTATAACCACAAATACCCATGCATAACATTGCACATATATGAG
CAAAGTTCAATGTGAATATAAAAGGATGACGTTCATATTTCAGCTTGGAGGGCCTTCATGGGAAGTACGACTTGGAAGGAGGGACTCGACCAGGGCGAGTAGGACAACGGCCAACACTGA
CATTCCCGCGCCAAACATGGACTTGCCTTCACTGATCAGCACGTTCCAAAAGCAAGGTCTCGACACACGGGACTTGGTCGCACTGAGCGGTGCGCACACAATTGGGTTCGCGCAATGTCG
CGTTTTCAGGAACCGCACATACAATGACGACAACATCGCCGCCGATTTCGCCGGGAGCCTCCAGTCCTTGTGCCCGCGTACTGGAGAGGACAGCAACCTCGCTGGTTTGGATCCTTCGCC
AGCTCAATTTGACGCATTGTACTTCCACAATCTGTTGGCGCAAAAGGGGCTTCTTCACTCTGATCAGGCGCTTTACAGTAGTGGGTCAACGGATGAGCTTGTGAAAACTTACAGCGATGA
TGTGGAGGCCTTTTGGGATGATTTTGCGAAGTCGATGATCAAGATGGGAAACATAAAGGNNNNNATCGGAAACCAGGGCCAGATCCGCTTGAATTGCCGGATGGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTTTGAGTAGCCTCAACTTCTTCCGAGCACTGCTCTTATTGTTCCTAGCGACGTCGGCTTTCTCGACGCGCCCTTACAAGGAAGGCCTCACGCCGCACTTCTACGACTACGCTTGT
CCTCAAGCTTTGCCTGCCGTCCAACGCATCGTGGAGGCAGCAGTGCAGCAGGAGCAACGCATGGGCGCTTCCTTACTGCGTTTGCACTTCCACGATTGTTTTGTTAAT
GGTTGCGATGCT
TCAATACTTTTGGATCCATCCCCTACCATTGACAGCGAAAAGCTCGCGTTTCCAAATAATAATTCAGCTATAGGGTTTGAAGTGATCGACCAAATTAAAGCAAAGGTGGACAAAGCTTGT
GGATACTCACTCGTATCTTGCGCCGACATCCTGGACATCGCAGCTCATGACTCTGTTGTTGCGGTA
CTTGGAGGGCCTTCATGGGAAGTACGACTTGGAAGGAGGGACTCGACCAGGGCG
AGTAGGACAACGGCCAACACTGACATTCCCGCGCCAAACATGGACTTGCCTTCACTGATCAGCACGTTCCAAAAGCAAGGTCTCGACACACGGGACTTGGTCGCACTGAGCGGTGCGCAC
ACAATTGGGTTCGCGCAATGTCGCGTTTTCAGGAACCGCACATACAATGACGACAACATCGCCGCCGATTTCGCCGGGAGCCTCCAGTCCTTGTGCCCGCGTACTGGAGAGGACAGCAAC
CTCGCTGGTTTGGATCCTTCGCCAGCTCAATTTGACGCATTGTACTTCCACAATCTGTTGGCGCAAAAGGGGCTTCTTCACTCTGATCAGGCGCTTTACAGTAGTGGGTCAACGGATGAG
CTTGTGAAAACTTACAGCGATGATGTGGAGGCCTTTTGGGATGATTTTGCGAAGTCGATGATCAAGATGGGAAACATAAAGGNNNNNATCGGAAACCAGGGCCAGATCCGCTTGAATTGC
CGGATGGTGA

Retrieve as FASTA