Entry information : EgrPrx29
Entry ID 8163
Creation 2011-03-01 (Christophe Dunand)
Last sequence changes 2012-08-23 (Catherine Mathe)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-24 (Christophe Dunand)
Peroxidase information: EgrPrx29
Name EgrPrx29
Class Class III peroxidase    [Orthogroup: Prx009]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx29
start..stop
S start..stop
EglPrx29 654 0 1..322 1..322
EguPrx29 622 0 1..322 1..322
EcamPrx25 583 0 1..322 1..322
EgrPrx25 575 0 1..322 1..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 11113310..11113534 225 N° 2 11115028..11115219 192 N° 3 11115339..11115504 166 N° 4 11115609..11115994 386
join(11113310..11113534,11115028..11115219,11115339..11115504,11115609..11115994 )


exon

Literature and cross-references EgrPrx29
DNA ref. Phytozome 12:   scaffold_1 (11113310..11115994)
Protein sequence: EgrPrx29
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (294)
PWM (Da):   %s   34197.52 (31093.9) Transmb domain:   %s   i13-35o
PI (pH):   %s   6.75 (6.23) Peptide Signal:   %s   cut: 29 range:29-322
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MACENSSPRRARPAFLLLLCFLLGTASARLSSTFYSTSCPSALHTIKSGVSSAVSSEASMDGSLLRLHFHDCFVNGCDASILLDDTMNFTGEKTADANDNSIHGYEVIDKIKSQLESSCPGVVSCADILAVAARDSVVALGGPSWTVLLGRRDSTTASLSAANSDLPASTLSLSDLITAFSNKGFTAKEMVALSGSHTIGQARCTTFRTRLYNESDINSMYATSLKANCQSSGGDNNLSPLDTMSPTYFDNAYFKNLQTQKGLLHSDQQLFSGGSTDAQVNMYSSNSATFMTDFANAMVKMGNLSPLTGSSGQIRKNCRKVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, 3 introns). No prediction from Phytozome. No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTGCGAGAACTCTTCTCCCAGACGGGCCAGACCCGCCTTCTTATTGTTGCTGTGTTTCCTACTTGGAACAGCCTCGGCTCGGCTGTCCAGCACTTTCTACTCCACATCCTGTCCC
AGCGCCCTCCACACCATTAAGTCCGGCGTGAGCTCCGCAGTGTCCAGCGAGGCCAGCATGGACGGGTCGCTGCTCCGCCTTCACTTCCACGATTGCTTCGTCAAT
GCAAGTCCCTCTCCT
CCGAGTCTCTCCTCTCTTTCACATTGATTTCTACCTTTGTTTGTCTTCTGTCGTTCAAGCTGCATGCAAGCGTGCGTGCATGATGCATCTTTATGCCTGTGCTTGTGAAACATTCCAGCC
ACCCTCATAGTCAAAGGCATCATTAGATTTCGCTTCTACGCATTAATGTACGCTCTTTTTCGCTAACCAAAACAGTAGGTACGAGATTCGCATAATGAATTAGTCGAGTCTGACTGACCT
TTTTGGTATATTGTTGGGCCATGCATTTTTGTGAGTTTACCAAGGGTGGACAAGAATGTTGTTGTGTATACTCTAATTTTTTTTATTACACAGACAATATATGCTATATTTTTCTCTATT
ATAAAACCATGCAGGCGAACGTACTTTATGCTGATCATGCTGTTGATAAGATGTGCGTGTATGATTAGCTACCTGTTTTAAACCCGATGAACTCGATGATTTAGATCATGCAAAGGTCCT
AAACGTTGCAGCTGGAAAAAGAGAGAGAGAGACGGCCATGCTTTTTAAGTCAAATAGGCGTTTATCACGTTTGGCAAAACCAATCAGTCTTCCTCAATAGGTTTCAATCATATTTTGATC
ACCATCCCTTTGGTTGCCATGCTTTTCTAAATTTAAAATGATATTTTATGGTAAAATATCAGTTTTAATGGAATTTCTTAATCCAATGGTATTCTAAAAATCATATTAGATCTTTGAATA
AATGAATTGCACCTTGTGCATGGCCTCACTAGTTTGCTTCCAACACAAATTTAGAGTGTCAATCTAAATTAACTAATTGATTTAGTGTACCTTCTTTGTGTTCGTTGTGCATAATTTAAG
AGTTGCCTGCATCCTAATGGACCTTTCTCCATCAAACATGCCGTCTCTACTTTGATCTTGATAGTCAAAGGCTGATCGATTTTTTAAATAACAAATATGACATGTTTACAATTTTCTCGA
TTAGATTTGTGGGTTGCTTTTCTTTTTCCTATATAGGTTGGAAATCATCTAGATTTTCATTCTTAATTGATACATAATTGGTCATTCGAGAAGGCCAAGCTCAGGCTAATTCTAGTGAAT
CATAAAGTCGGTTACTCCCCTCTGTTAAATATTAAAGAACGTGCCATGTTGCTAACCAAAAATCTTGATTTAGAGAACACTTCACAGCGCAATCATTTTGTTTCTAGTCCGACGATTATT
GGATGCATTGTTCCATGAGAAACAACTCGGAGTAAAGTCAAAAGGCATGAGAAAGAGTGTCACCCCCGTCCAAACTGGTGTCTCAAGTCGTTCATAGTAGGGGACAAAAAGGGGGAATGA
TAAGGGAAACAACCAGTGTTTATGCTCTAATTTCAGGAAAATTTACAACACCCAAACCTCCTGTCTCCAACCAACCAATGAATGAAATGAACGCCAATCGGATCGATTTTCCAACTAGAA
TGGCTGATTAATAATGTGTGGTGCAAAATATGAAACAGGGATGTGACGCGTCGATTTTGTTGGATGACACCATGAACTTCACCGGGGAGAAGACCGCCGACGCGAATGACAATTCCATAC
ATGGATACGAGGTGATCGACAAAATCAAGTCCCAACTGGAGAGCAGCTGCCCTGGGGTCGTGTCCTGTGCTGACATCTTGGCCGTCGCCGCGCGTGATTCTGTTGTTGCC
GTAAGTGCAC
ATTTTCTTCTCAACACTAGCGATCAATTGGGAGGAAAAAATCACATGCTATGTTACCTTTCTATATTAGCACTAACATGTTTGGATTTATTTGTTTATTTAATTTTCAGTTAGGTGGCCC
AAGTTGGACAGTCTTATTAGGAAGAAGAGACTCGACCACCGCAAGCCTAAGTGCTGCTAATAGCGACCTTCCTGCCTCAACTTTGAGCCTTAGCGACCTCATCACCGCCTTCTCTAACAA
AGGCTTCACTGCCAAAGAAATGGTGGCACTTTCAG
GTCTTCGTTTTTTTTTTGGTTGCATTTTATAATAAAGAATTATAATAAAGCTCGACTGATTTACTAAGATCGATTTACAAAAACT
GTTCAATTGTTGTCAATAGGATCGCACACGATAGGTCAAGCCCGATGCACAACTTTCCGGACCCGACTTTATAATGAGAGCGACATCAACAGCATGTACGCAACGTCACTAAAAGCAAAC
TGCCAGAGCTCCGGAGGTGACAACAATCTCTCTCCTCTCGACACCATGAGCCCGACATACTTTGACAACGCCTACTTCAAGAACTTGCAGACCCAAAAGGGGCTTCTTCACTCGGACCAG
CAATTGTTCAGTGGTGGTTCCACGGACGCTCAAGTGAACATGTACAGTAGCAATTCGGCTACTTTCATGACAGATTTTGCTAACGCCATGGTGAAGATGGGTAACCTCAGCCCACTCACC
GGCTCAAGCGGTCAGATTAGGAAGAACTGCAGGAAAGTCAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTGCGAGAACTCTTCTCCCAGACGGGCCAGACCCGCCTTCTTATTGTTGCTGTGTTTCCTACTTGGAACAGCCTCGGCTCGGCTGTCCAGCACTTTCTACTCCACATCCTGTCCC
AGCGCCCTCCACACCATTAAGTCCGGCGTGAGCTCCGCAGTGTCCAGCGAGGCCAGCATGGACGGGTCGCTGCTCCGCCTTCACTTCCACGATTGCTTCGTCAAT
GGATGTGACGCGTCG
ATTTTGTTGGATGACACCATGAACTTCACCGGGGAGAAGACCGCCGACGCGAATGACAATTCCATACATGGATACGAGGTGATCGACAAAATCAAGTCCCAACTGGAGAGCAGCTGCCCT
GGGGTCGTGTCCTGTGCTGACATCTTGGCCGTCGCCGCGCGTGATTCTGTTGTTGCC
TTAGGTGGCCCAAGTTGGACAGTCTTATTAGGAAGAAGAGACTCGACCACCGCAAGCCTAAGT
GCTGCTAATAGCGACCTTCCTGCCTCAACTTTGAGCCTTAGCGACCTCATCACCGCCTTCTCTAACAAAGGCTTCACTGCCAAAGAAATGGTGGCACTTTCAG
GATCGCACACGATAGGT
CAAGCCCGATGCACAACTTTCCGGACCCGACTTTATAATGAGAGCGACATCAACAGCATGTACGCAACGTCACTAAAAGCAAACTGCCAGAGCTCCGGAGGTGACAACAATCTCTCTCCT
CTCGACACCATGAGCCCGACATACTTTGACAACGCCTACTTCAAGAACTTGCAGACCCAAAAGGGGCTTCTTCACTCGGACCAGCAATTGTTCAGTGGTGGTTCCACGGACGCTCAAGTG
AACATGTACAGTAGCAATTCGGCTACTTTCATGACAGATTTTGCTAACGCCATGGTGAAGATGGGTAACCTCAGCCCACTCACCGGCTCAAGCGGTCAGATTAGGAAGAACTGCAGGAAA
GTCAACTGA

Retrieve as FASTA