Entry information : EgrPrx50
Entry ID 8165
Creation 2011-03-01 (Christophe Dunand)
Last sequence changes 2011-03-01 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-02-15 (Qiang Li)
Peroxidase information: EgrPrx50
Name EgrPrx50
Class Class III peroxidase    [Orthogroup: Prx057]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx50
start..stop
S start..stop
EglPrx52 678 0 1..333 1..333
EgrPrx52 676 0 1..333 1..333
EcamPrx50 672 0 1..333 1..333
EguPrx50 610 0 1..333 1..333
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 35205358..35205582 225 N° 2 35205691..35205882 192 N° 3 35206010..35206175 166 N° 4 35206876..35207294 419
join(35205358..35205582,35205691..35205882,35206010..35206175,35206876..35207294 )


exon

Literature and cross-references EgrPrx50
DNA ref. Phytozome 12:   scaffold_1 (35205358..35207294)
Protein sequence: EgrPrx50
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   333 (305)
PWM (Da):   %s   35540.69 (32799.2)  
PI (pH):   %s   5.05 (5.05) Peptide Signal:   %s   cut: 29 range:29-333
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAGSSTPSSLTAVTLLAALLLFLNPSNAQLTANFYAKTCPSVSSIVQTVIQEALQSDPRITASLLRLHFHDCFVDGCDGSLLLDNSPTIKSEKDAAPNFKSARGFDVVDKIKAAIESACPGTVSCADILALAAQASVSLSEGPYWTVLLGRRDSLTANQAGANTSIPSPFDSYNNLVSKFSAVGLDITDLATLSGAHTFGRAQCKSFNPRLYNFTANGGPDPTINPWYLTNLRKLCPQNGDSSVLADLDPTTPNLFDNHYYSNLQKNEGLLLSDQELYSTTGAATISIVNSFSFDQSAFFESFARSIVNMGNISPLTGSNGEIRFNCRKVNWS

Retrieve as FASTA  
Remarks complete sequence from genomic (chromo 1, 3 introns). No prediction from Phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGGTTCTTCTACTCCTTCCTCGCTGACGGCGGTGACCCTTCTCGCCGCATTGTTGTTGTTCCTCAATCCGTCGAACGCTCAACTGACTGCCAATTTTTATGCGAAGACATGCCCG
AGCGTGTCCAGTATTGTCCAAACCGTGATCCAGGAGGCCCTTCAATCTGACCCACGCATCACTGCCAGCCTCCTCCGTCTCCATTTCCACGATTGTTTCGTCGAC
GTGAGTCCCTAAGCT
AGATCAATTCCCATTAACAATGGTTCTCTCAATCTGATTACCAAGTAGCTAGTCACGCAACCTAATGTTTAAGCCTGACATGTGTGTTAAAAGGGGTGTGATGGATCGCTGCTGCTGGAC
AATAGCCCAACCATAAAGAGCGAGAAAGATGCAGCTCCGAATTTTAAGTCCGCAAGAGGGTTTGATGTCGTGGACAAGATCAAAGCGGCTATCGAGAGTGCTTGTCCAGGGACCGTGTCT
TGCGCCGACATTCTTGCCCTTGCTGCTCAAGCTTCCGTCTCTTTG
GTATATGTAGTTATAGTCAAAGAAACATAAACATAAATCTAAAGTATATTCAGGGTTCATTATTATAACTCACCC
TACTCAAATCATTATTGTATTTCTCTTGATTATCACTCTTACCAAATTGCAGTCAGAAGGTCCATATTGGACAGTGCTCTTGGGGAGGAGGGACAGCTTGACCGCGAACCAAGCCGGAGC
GAACACATCGATACCCTCCCCTTTTGATAGCTATAACAACCTCGTTTCCAAATTCTCTGCTGTTGGCTTGGACATCACCGACCTTGCTACACTTTCCG
GTAAAAAAGAACAATTGGACTT
GCATTTTAATACGAAACGTGCAACTGTAGATATTGATGCACAAAAAAGATTTATAGAGTGAGATGCTGGATTTTTGTCACATAATTTATCGGCACAAACATCTCTTCACTTTTGTTTAAC
ACATTCTAACTTCCTTATATGATCATGGTCTAAGATTAATTGTAATCTATTGACATGCCTGTCTGGTACATGGCCTATGCACGCCTCGTGCATAGGCCATGCACATCTACTAGAAGGAAT
TTTGGCTAAGGATTATTAATCTATAATTGAATAAGTAATTTGCCCTTGACTTGAGATCGATTGACATGCATGTGTTATGCCTAGGCCATGCCTGTATCATGCATGGACCATGCACATCTA
CTAGAACGAATTTTGGCTAAGGATTAAGGATTTCTTTTTCATCACAAGAGTATGAATATCGGGAAAGATGGTATCAAAATTTGCAAGCCCCTCATGTACTTATCCAAGAAATGCTATGTT
TACATAATCAATATATTAAGTGATGTCGCAAATCGTTATTACTTATTCATATATCCACTAATGAGTTTGCTGCATATGTTTGGCATACAAATTCCGTTGAGCATTCCTAGCATTGATCTA
TTCATCCATCTCCATAATTAAGCATCTGCAGATATTTGTTCTCTTAGCTAACTTTTCGTGCATACGACAATAAAACAGGAGCTCACACCTTCGGACGTGCACAGTGCAAGTCATTCAACC
CTAGGCTCTACAACTTCACCGCGAACGGTGGCCCTGATCCCACCATAAACCCGTGGTACTTGACCAATCTCCGGAAACTTTGCCCTCAGAATGGCGACAGTAGTGTCCTCGCCGACCTCG
ACCCGACAACCCCAAACTTGTTTGACAACCACTACTACTCCAACCTCCAGAAAAATGAAGGGCTTCTTCTGTCCGATCAAGAGCTGTACTCCACAACTGGCGCCGCAACAATTTCCATCG
TCAACAGCTTTAGCTTTGACCAGAGTGCCTTCTTCGAGAGCTTCGCTCGGTCGATAGTAAACATGGGAAATATTAGTCCTCTCACCGGAAGTAACGGGGAGATCCGGTTCAATTGTAGGA
AGGTCAATTGGAGTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGGTTCTTCTACTCCTTCCTCGCTGACGGCGGTGACCCTTCTCGCCGCATTGTTGTTGTTCCTCAATCCGTCGAACGCTCAACTGACTGCCAATTTTTATGCGAAGACATGCCCG
AGCGTGTCCAGTATTGTCCAAACCGTGATCCAGGAGGCCCTTCAATCTGACCCACGCATCACTGCCAGCCTCCTCCGTCTCCATTTCCACGATTGTTTCGTCGAC
GGGTGTGATGGATCG
CTGCTGCTGGACAATAGCCCAACCATAAAGAGCGAGAAAGATGCAGCTCCGAATTTTAAGTCCGCAAGAGGGTTTGATGTCGTGGACAAGATCAAAGCGGCTATCGAGAGTGCTTGTCCA
GGGACCGTGTCTTGCGCCGACATTCTTGCCCTTGCTGCTCAAGCTTCCGTCTCTTTG
TCAGAAGGTCCATATTGGACAGTGCTCTTGGGGAGGAGGGACAGCTTGACCGCGAACCAAGCC
GGAGCGAACACATCGATACCCTCCCCTTTTGATAGCTATAACAACCTCGTTTCCAAATTCTCTGCTGTTGGCTTGGACATCACCGACCTTGCTACACTTTCCG
GAGCTCACACCTTCGGA
CGTGCACAGTGCAAGTCATTCAACCCTAGGCTCTACAACTTCACCGCGAACGGTGGCCCTGATCCCACCATAAACCCGTGGTACTTGACCAATCTCCGGAAACTTTGCCCTCAGAATGGC
GACAGTAGTGTCCTCGCCGACCTCGACCCGACAACCCCAAACTTGTTTGACAACCACTACTACTCCAACCTCCAGAAAAATGAAGGGCTTCTTCTGTCCGATCAAGAGCTGTACTCCACA
ACTGGCGCCGCAACAATTTCCATCGTCAACAGCTTTAGCTTTGACCAGAGTGCCTTCTTCGAGAGCTTCGCTCGGTCGATAGTAAACATGGGAAATATTAGTCCTCTCACCGGAAGTAAC
GGGGAGATCCGGTTCAATTGTAGGAAGGTCAATTGGAGTTGA

Retrieve as FASTA