Entry information : EgrPrx21
Entry ID 8171
Creation 2011-03-02 (Christophe Dunand)
Last sequence changes 2011-03-02 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-02-15 (Qiang Li)
Peroxidase information: EgrPrx21
Name EgrPrx21
Class Class III peroxidase    [Orthogroup: Prx009]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx21
start..stop
S start..stop
EglPrx21 645 0 1..319 1..319
EguPrx21 643 0 1..319 1..319
EcamPrx22 640 0 1..319 1..319
EcamPrx21 639 0 1..319 1..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 10916704..10916919 216 N° 2 10918498..10918689 192 N° 3 10918812..10918977 166 N° 4 10919086..10919471 386
join(10916704..10916919,10918498..10918689,10918812..10918977,10919086..10919471 )


exon

Literature and cross-references EgrPrx21
DNA ref. Phytozome 12:   scaffold_1 (10916704..10919471)
Protein sequence: EgrPrx21
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   319 (294)
PWM (Da):   %s   33283.38 (30587.0)  
PI (pH):   %s   8.15 (8.21) Peptide Signal:   %s   cut: 26 range:26-319
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARESSSVRSAFLLLLCFLLETASAQLSSTFYSTSCPSALSTIKSGVSSAVKSEARMGASLLRLHFHDCFVNGCDASVLLDDTANFTGEKNAGPNANSLRGFNVIDTIKSQLESACPGIVSCADLLTVAARDSVVALGGPSWTVPLGRRDSTTASQSAANSNIPAFTLSLSGLITAFSNKGFTAKEMVALSGSHTIGQARCTTFRTRLYNENNINATFATSLKANCPSSGGDNNLSPLDTTSPTSFDNAYFKNLQIQKGLLHSDQQLFSGGSTDAQVNAYSSNSATFMTDFANAMVKMGNLSPLTGSSGQIRKSCGKVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, 3 introns). No prediction from Phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCGTGAGAGCTCTTCTGTCAGATCCGCCTTCTTATTGTTGCTGTGTTTTCTTCTGGAAACAGCCTCAGCTCAGCTGTCCAGTACTTTCTACTCCACCTCCTGTCCCAGCGCCCTC
TCCACCATTAAATCCGGCGTGAGCTCTGCGGTCAAAAGTGAGGCCCGCATGGGCGCATCGCTGCTCCGCCTTCACTTCCACGATTGCTTCGTTAAT
GCAAGTCCCTCTGCCCGGAGTCTC
TCCTCTCTTTCCGATTGATTGCTACCTTTGTTTCTCTTCTGTCACTCAAGCTGCATGCAAGCGTGCATGCAGGATGCATCTTTGTGCTTTTGTGCATGTGAAACGTTCCAACCGACCTCA
TAGTCAAAAAGAATGATTAGATTTCGCTTCTACGCAAGTTACTCTCTTTTTCACTAACCAAACAATAGGTAGGAAGTACACATATTGAATTAATCGAGTCTGACCGACCCTTTTTGTGCC
ATGCATTTTTGTGAGTTTATTATTATTATAATAATAATAGGCTGTGTTTATTGAAGTCGTTTTAAAATTAGAGCTATGTTTTCATTCAAACAGCAATAAAAAGCATGGCCCTTAGAATAA
AAGCACTTCTTTTTGGTGATTCAAAGAAAAAAAAAATTCATGAGAAATTCTAGTATGCACCGCTAGTGTAAAAATCTCATTCCGTAAGTGGTCTTATCTACTAGATATTTTGGTGCTTGG
GGAGAGAGTTGGTAATTAGAATCCTCGAATCAAGATGGACAAGAATATTGTTGTGCGTGCTCTAATTTTTTTTTTTTTCATTTATTATATCGACAATGTAAGCCATGCAGGCGAGCGTAT
TTTATGCCGAGTATGTTGTGGATAAGACGTGTTTGTGTATGATTAGCTACATGATTTTAAATTTGATGAATTAGATCACGCAAAAGTCCTAGTCGTTGGAGATGGCAAAAAGAGAGAGCG
ACAGCCATGCTTTTATGACGGTGGTTGACTTTACGCGTTTTTCATGTTTGGCAAATCAATCAGTTGTTTTCAATAGGTTTTGGTCATATTTTGATCACCGTCACTTCGGTTGCCATACTT
TTCTACATTAAAAATGATATTTTGCTATAAATATCTTTTTTTAATGAAATTTTTTAATCCAATGGTGTTCTAAAAATTGTATTAGATCTTTTAAACAATTTGAAGTACCTTCATTGTTAT
CCACTTCGTGTTCTTTGTGCATAATTCAAGAGTTGTCCATATCCTAATGGGCCTTTCTCCATCTAACATGCCGTCTCTATTTCAAACTTGATATTTAAGCTTGATCCATTTTTCTCGATT
AGATGCTTTTCTCTTTTCCTGTATGGGTTGGAAATTGTCTAGATCTTCAAGGTCATTCGAGAAGACAAAATTCAGGCTAATTCTAGTAAATCAAAAAGTCGGTGACTCCCCTCTGTTGAA
TATTAAAGGACACGCCATGTTGCTAACCAAAAGCCTTGATTTAGAAAAACATCATAGCACAATCATTTTGTTTCTAGTCCGACAATTATTGGATGCATTATTTCTAGAGAGACGACACAA
ATTAAAGTCAAAAGGCACGAGAAAGAGTGTCATTCCCGTCCAAACTGGTGTCTGCGGGCGTTCATAATGGGGGACAAAAGGGGGAAAATGATAAGGGAAATTAATCAGTGTTCATACTTT
ATGTTCAGGAAAAGTTATAGCACTCGTTCTGTTTATATTTTGACCGTTGAATCTAATGAATTCAATAGGATCTATTTGACTAATTAACGATGTGTGGCACAAAATATACAATAGGGATGC
GACGCATCTGTTCTATTGGACGACACTGCAAACTTCACTGGGGAGAAGAATGCTGGCCCAAATGCCAATTCCTTACGGGGATTCAACGTGATTGACACAATCAAATCCCAATTGGAGAGT
GCATGCCCCGGCATCGTGTCCTGCGCTGATCTCTTGACCGTGGCTGCGCGAGATTCCGTCGTCGCT
GTAAGTGCACACTGTTTTCTTAATTCTAGTGATCAATTGTGATGAGAAAAAATC
ACTCGTTATGATCTCGATGCCGCATCAATACTAACACGTGTGGATTTGTTTAACTATTTAATTCTTAGTTAGGTGGCCCAAGTTGGACAGTCCCGCTAGGAAGAAGAGACTCAACCACTG
CAAGCCAAAGTGCTGCTAATAGCAACATCCCTGCCTTTACTTTGAGCCTTAGCGGCCTCATCACTGCCTTCTCTAACAAAGGTTTCACCGCCAAAGAAATGGTGGCACTCTCAG
GTCATT
ATTTTACTTTTTTTTGTGGCACCTTTTAATAACGAATTTACAATTATGCTTGATCGATATACTAAGATTAATATTAAAACGTTGTTCGATTGTTGTTAACAGGGTCGCACACGATAGGTC
AAGCCCGATGCACAACTTTCCGGACCCGTCTTTACAACGAGAACAACATCAACGCCACGTTCGCAACCTCGCTCAAGGCGAACTGCCCAAGCTCCGGAGGCGACAACAATCTCTCTCCTC
TAGACACCACGAGCCCGACGTCCTTCGACAATGCCTACTTTAAGAACTTGCAAATCCAAAAAGGTCTTCTTCACTCGGATCAGCAATTGTTTAGTGGTGGTTCCACGGACGCTCAAGTGA
ACGCTTATAGCAGCAATTCAGCTACTTTCATGACAGATTTTGCTAACGCCATGGTGAAGATGGGTAACCTCAGCCCGCTCACCGGCTCAAGCGGTCAGATTAGGAAGAGTTGCGGGAAAG
TCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCGTGAGAGCTCTTCTGTCAGATCCGCCTTCTTATTGTTGCTGTGTTTTCTTCTGGAAACAGCCTCAGCTCAGCTGTCCAGTACTTTCTACTCCACCTCCTGTCCCAGCGCCCTC
TCCACCATTAAATCCGGCGTGAGCTCTGCGGTCAAAAGTGAGGCCCGCATGGGCGCATCGCTGCTCCGCCTTCACTTCCACGATTGCTTCGTTAAT
GGATGCGACGCATCTGTTCTATTG
GACGACACTGCAAACTTCACTGGGGAGAAGAATGCTGGCCCAAATGCCAATTCCTTACGGGGATTCAACGTGATTGACACAATCAAATCCCAATTGGAGAGTGCATGCCCCGGCATCGTG
TCCTGCGCTGATCTCTTGACCGTGGCTGCGCGAGATTCCGTCGTCGCT
TTAGGTGGCCCAAGTTGGACAGTCCCGCTAGGAAGAAGAGACTCAACCACTGCAAGCCAAAGTGCTGCTAAT
AGCAACATCCCTGCCTTTACTTTGAGCCTTAGCGGCCTCATCACTGCCTTCTCTAACAAAGGTTTCACCGCCAAAGAAATGGTGGCACTCTCAG
GGTCGCACACGATAGGTCAAGCCCGA
TGCACAACTTTCCGGACCCGTCTTTACAACGAGAACAACATCAACGCCACGTTCGCAACCTCGCTCAAGGCGAACTGCCCAAGCTCCGGAGGCGACAACAATCTCTCTCCTCTAGACACC
ACGAGCCCGACGTCCTTCGACAATGCCTACTTTAAGAACTTGCAAATCCAAAAAGGTCTTCTTCACTCGGATCAGCAATTGTTTAGTGGTGGTTCCACGGACGCTCAAGTGAACGCTTAT
AGCAGCAATTCAGCTACTTTCATGACAGATTTTGCTAACGCCATGGTGAAGATGGGTAACCTCAGCCCGCTCACCGGCTCAAGCGGTCAGATTAGGAAGAGTTGCGGGAAAGTCAACTAA

Retrieve as FASTA