Entry information : SbPrx138 (Sobic.010G162000.1 [2.1] / SB10G021650 [1.4])
Entry ID 820
Creation 2005-12-26 (Christophe Dunand)
Last sequence changes 2005-12-26 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbPrx138 (Sobic.010G162000.1 [2.1] / SB10G021650 [1.4])
Name (synonym) SbPrx138 (Sobic.010G162000.1 [2.1] / SB10G021650 [1.4])
Class Class III peroxidase    [Orthogroup: Prx027]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue types Callus
Cell culture
Leaves
Roots
Seedlings
Inducers Acid treatment
Alkaline treatment
Dark growth
Ethylene treatment
Oxidative stress
Pathogen interaction
Salt stress
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx138
start..stop
S start..stop
OsPrx86 558 0 29..325 28..324
SiPrx33 556 0 1..325 1..325
TaPrx32 547 0 1..325 1..322
BdiPrx23 525 0 1..325 1..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 47787689..47787922 234 N° 2 47787389..47787580 192 N° 3 47786737..47787288 552  
complement(join(47786737..47787288,47787389..47787580,47787689..47787922))


exon

Literature and cross-references SbPrx138 (Sobic.010G162000.1 [2.1] / SB10G021650 [1.4])
Literature Cordonnier-Pratt,M.-M. et al., unpublished
DNA ref. Phytozome 12:   chromosome_10 (47787922..47786737)
Protein sequence: SbPrx138 (Sobic.010G162000.1 [2.1] / SB10G021650 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325 (295)
PWM (Da):   %s   34295 (31356.5) Transmb domain:   %s   i9-28o
PI (pH):   %s   8.64 (8.75) Peptide Signal:   %s   cut: 31 range:31-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATFTCRSMAFLSLAAAVLVALLTAGAADAQKLSPNFYSKTCPNVATIVRQQMASAVAAEKRMGASILRMFFHDCFVNGCDGSILLDDTSTFTGEKGAGPNANSVRGFEVIDAIKTKVEASCKATVSCADILALAARDGVNLLGGPTWSVPLGRKDSRTASQSLANSNLPGPGSSLATLIRMFGNQGLSARDMTALSGAHTIGRSQCQFFRSRIYTESNINASFAALRQKTCPRSGGDATLAPFDVQTPDGFDNAYYQNLVAQKGLLHSDQELFNGGSQDALVRQYSTNANQFSADFVSAMIKMGNLMPSSGTPTEVRLNCRKTN*

Retrieve as FASTA  
Remarks Complete sequence from 24 ESTs and genomic (chromo 10, introns 1 and 2)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCACATTCACCTGCAGGTCCATGGCCTTCCTCTCCCTCGCCGCCGCCGTCCTCGTTGCCCTACTCACCGCCGGCGCCGCGGACGCGCAGAAGCTCTCCCCCAACTTCTACTCCAAG
ACGTGCCCGAACGTGGCCACCATCGTGCGGCAGCAGATGGCGTCCGCCGTCGCGGCGGAGAAGCGTATGGGCGCCTCCATTCTCCGCATGTTCTTCCACGACTGCTTCGTCAAT
GTAAGA
GAGATACCTACACTACAGCTGCTAGCTGTTTGCACTGAACGTACGTGCGCGTGCTGACGTTTTGCTGCTCTGGTTTTTTTTTTTTTTGTCGAATGCCGCCAGGGCTGCGACGGCTCCATC
CTCCTCGACGACACGTCCACCTTCACCGGCGAGAAGGGCGCCGGCCCCAACGCCAACTCCGTCCGCGGGTTCGAGGTCATCGACGCCATCAAGACGAAGGTGGAGGCCTCCTGCAAGGCC
ACCGTCTCCTGCGCCGACATCCTCGCCCTCGCCGCCCGTGACGGGGTCAACCTG
GTCAGCAGTCCTCTGCTTCTTCTTCCTCCCGGTGACGACCGACGACCCTCTCGTCACACGGCTAAT
ACAGTAGTCTATGTCTATATATACAACAATGCAGCTGGGAGGGCCGACATGGAGCGTGCCGCTGGGCCGGAAGGACTCGCGGACGGCGAGCCAGAGCCTGGCGAACTCGAACCTGCCAGG
CCCGGGGTCAAGCCTGGCCACGCTCATCAGGATGTTCGGCAACCAGGGCCTGTCGGCGCGCGACATGACGGCGCTGTCGGGGGCGCACACCATCGGCAGGTCGCAGTGCCAGTTCTTCCG
CAGCCGGATCTACACCGAGAGCAACATCAACGCCAGCTTCGCCGCGCTGCGGCAGAAGACGTGCCCGCGCTCCGGCGGCGACGCCACGCTCGCGCCGTTCGACGTGCAGACGCCCGACGG
CTTCGACAACGCCTACTACCAGAACCTGGTGGCGCAGAAGGGCCTGCTGCACTCGGACCAGGAGCTCTTCAATGGCGGGTCGCAGGACGCGCTGGTCAGGCAGTACAGCACCAACGCCAA
CCAGTTCTCCGCGGACTTCGTCTCCGCCATGATCAAGATGGGCAACCTCATGCCGTCGTCAGGGACGCCCACGGAAGTCAGGCTCAACTGCAGGAAGACGAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCACATTCACCTGCAGGTCCATGGCCTTCCTCTCCCTCGCCGCCGCCGTCCTCGTTGCCCTACTCACCGCCGGCGCCGCGGACGCGCAGAAGCTCTCCCCCAACTTCTACTCCAAG
ACGTGCCCGAACGTGGCCACCATCGTGCGGCAGCAGATGGCGTCCGCCGTCGCGGCGGAGAAGCGTATGGGCGCCTCCATTCTCCGCATGTTCTTCCACGACTGCTTCGTCAAT
GGCTGC
GACGGCTCCATCCTCCTCGACGACACGTCCACCTTCACCGGCGAGAAGGGCGCCGGCCCCAACGCCAACTCCGTCCGCGGGTTCGAGGTCATCGACGCCATCAAGACGAAGGTGGAGGCC
TCCTGCAAGGCCACCGTCTCCTGCGCCGACATCCTCGCCCTCGCCGCCCGTGACGGGGTCAACCTG
CTGGGAGGGCCGACATGGAGCGTGCCGCTGGGCCGGAAGGACTCGCGGACGGCG
AGCCAGAGCCTGGCGAACTCGAACCTGCCAGGCCCGGGGTCAAGCCTGGCCACGCTCATCAGGATGTTCGGCAACCAGGGCCTGTCGGCGCGCGACATGACGGCGCTGTCGGGGGCGCAC
ACCATCGGCAGGTCGCAGTGCCAGTTCTTCCGCAGCCGGATCTACACCGAGAGCAACATCAACGCCAGCTTCGCCGCGCTGCGGCAGAAGACGTGCCCGCGCTCCGGCGGCGACGCCACG
CTCGCGCCGTTCGACGTGCAGACGCCCGACGGCTTCGACAACGCCTACTACCAGAACCTGGTGGCGCAGAAGGGCCTGCTGCACTCGGACCAGGAGCTCTTCAATGGCGGGTCGCAGGAC
GCGCTGGTCAGGCAGTACAGCACCAACGCCAACCAGTTCTCCGCGGACTTCGTCTCCGCCATGATCAAGATGGGCAACCTCATGCCGTCGTCAGGGACGCCCACGGAAGTCAGGCTCAAC
TGCAGGAAGACGAACTAA

Retrieve as FASTA