Entry information : SbPrx34 (Sobic.002G357000.1 [2.1] / SB02G037840 [1.4])
Entry ID 821
Creation 2005-12-30 (Christophe Dunand)
Last sequence changes 2005-12-30 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbPrx34 (Sobic.002G357000.1 [2.1] / SB02G037840 [1.4])
Name (synonym) SbPrx34 (Sobic.002G357000.1 [2.1] / SB02G037840 [1.4])
Class Class III peroxidase    [Orthogroup: Prx173]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue types Leaves
Seedlings
Inducers Acid treatment
Alkaline treatment
Ethylene treatment
Nitrogen starvation
Salt stress
Wounding
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx34
start..stop
S start..stop
ZmPrx93 585 0 1..325 1..326
SiPrx126 525 0 1..325 1..308
OsPrx4849 455 1e-162 15..325 1..313
SiPrx122 440 1e-156 13..325 24..338
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 72092800..72093033 234 N° 2 72093141..72093332 192 N° 3 72093443..72093608 166 N° 4 72093875..72094260 386
join(72092800..72093033,72093141..72093332,72093443..72093608,72093875..72094260 )


exon

Literature and cross-references SbPrx34 (Sobic.002G357000.1 [2.1] / SB02G037840 [1.4])
Literature Cordonnier-Pratt,M.-M. et al., unpublished
DNA ref. Phytozome 12:   chromosome_2 (72092800..72094260)
Cluster/Prediction ref. PlantGDB:   SbGSStuc11-12-04.1597.1
Protein sequence: SbPrx34 (Sobic.002G357000.1 [2.1] / SB02G037840 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325 (294)
PWM (Da):   %s   33255.8 (29999.9)  
PI (pH):   %s   8.75 (7.70) Peptide Signal:   %s   cut: 32 range:32-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAARSSHRFRHSKLSVLILALATVVAAARAQLSPTFYASSCPAALVTIKTAVRAALVLDRRMGASLLRLHFHDCFVQGCDASVLLDDTGNFTGEKSAGPNAGSLRGFGVIDTIKALLEALCPRTVSCADILAVAARDSVVALGGPSWTVQLGRRDSTTASLSTANTDLPSPASSLSTLLAAFARKGLSSTDMVALSGAHTAGQAQCQNYQARIYNDANINAAFAASLRAGCPAGGGGGANAPLDASTPNAFDNAYYGDLVAQQGLLHSDQELFNGGSTDGLVRSYAASSARFSSDFAAAMVKMGGIGVITGSSGEVRRNCRRVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, 3 introns) and 15 ESTs
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCTGCACGCAGCAGCCATCGCTTTCGCCACTCCAAGCTCTCAGTACTGATCCTGGCACTGGCCACGGTGGTGGCCGCCGCACGGGCTCAGCTTTCGCCGACGTTCTACGCCTCG
TCGTGCCCTGCCGCGCTCGTCACCATCAAGACCGCCGTGCGGGCTGCTCTGGTGCTGGACCGGCGCATGGGCGCCTCCCTGCTCCGGCTTCACTTCCACGACTGCTTCGTGCAG
GCAAGT
CGATCCACAGCAGTCGCGCGGTCGAGGTGTAGGACTCTTTGTGAACCAGTCGTGTGACGAGCTGTGTATATACCTGCTGCCTGTGTATGTGCGTGCGCCAGGGCTGCGACGCGTCCGTTC
TGCTGGACGACACGGGCAACTTCACCGGGGAGAAGAGCGCGGGCCCGAACGCGGGGTCGCTCAGGGGGTTCGGCGTCATCGACACCATCAAGGCCCTGCTGGAGGCGCTGTGCCCGCGGA
CCGTGTCGTGCGCCGACATCCTCGCCGTCGCCGCCCGTGACTCTGTCGTCGCG
GTACGGATGACAATCATCCCAATCATGAGCCAGTCGCAGTAGTATTCACGCGGAGGACTCCAGCTCA
CTTAACACAGTTAACACATTGTCTTGCGATCTTGGGTGTGCAGCTAGGAGGGCCATCGTGGACGGTGCAGCTCGGCAGGAGGGACTCCACCACGGCGAGCCTCTCCACCGCGAACACCGA
CCTCCCCTCGCCGGCGTCCAGCCTGAGCACCCTGCTCGCCGCATTCGCCAGGAAAGGCCTGAGCAGCACCGACATGGTCGCTCTGTCTG
GTGCGTTCCTCGCTGTCGTCACTGACCAATC
CAATCACACGGTTTCATCAGTGATCAGCCAGCACCACAGCGCCTGATCGATCGAGTTCAGTGACGTCCTGGCATGGTCACCGACGACGACGTGACCATGCAACTACCAGTTCCCCCTCTG
TGCCTCTACTCTAACAGCGGTGGCAGCTTGGCAGCTAGCACCCGCGCCACCGCCCCCCACCGCCACGTACCGCTGGTCACCACTGACACGTGACGCGGTTGCGTTGTGCATGCAGGAGCC
CACACGGCGGGGCAGGCGCAGTGCCAGAACTACCAGGCCAGGATCTACAACGACGCCAACATCAACGCGGCCTTCGCGGCGTCGCTGAGGGCCGGCTGCCCGGCCGGCGGCGGGGGCGGC
GCGAACGCGCCGCTGGACGCGTCCACGCCGAACGCGTTCGACAACGCGTACTACGGCGACCTGGTCGCGCAGCAGGGGTTGCTGCACTCCGATCAAGAGCTCTTCAACGGCGGCTCCACG
GACGGACTGGTCAGGAGCTACGCAGCCAGCTCGGCGCGGTTCAGTAGCGACTTCGCCGCTGCCATGGTCAAGATGGGCGGCATTGGTGTCATAACCGGGAGCAGCGGAGAGGTCCGGCGC
AACTGCCGGAGGGTGAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCTGCACGCAGCAGCCATCGCTTTCGCCACTCCAAGCTCTCAGTACTGATCCTGGCACTGGCCACGGTGGTGGCCGCCGCACGGGCTCAGCTTTCGCCGACGTTCTACGCCTCG
TCGTGCCCTGCCGCGCTCGTCACCATCAAGACCGCCGTGCGGGCTGCTCTGGTGCTGGACCGGCGCATGGGCGCCTCCCTGCTCCGGCTTCACTTCCACGACTGCTTCGTGCAG
GGCTGC
GACGCGTCCGTTCTGCTGGACGACACGGGCAACTTCACCGGGGAGAAGAGCGCGGGCCCGAACGCGGGGTCGCTCAGGGGGTTCGGCGTCATCGACACCATCAAGGCCCTGCTGGAGGCG
CTGTGCCCGCGGACCGTGTCGTGCGCCGACATCCTCGCCGTCGCCGCCCGTGACTCTGTCGTCGCG
CTAGGAGGGCCATCGTGGACGGTGCAGCTCGGCAGGAGGGACTCCACCACGGCG
AGCCTCTCCACCGCGAACACCGACCTCCCCTCGCCGGCGTCCAGCCTGAGCACCCTGCTCGCCGCATTCGCCAGGAAAGGCCTGAGCAGCACCGACATGGTCGCTCTGTCTG
GAGCCCAC
ACGGCGGGGCAGGCGCAGTGCCAGAACTACCAGGCCAGGATCTACAACGACGCCAACATCAACGCGGCCTTCGCGGCGTCGCTGAGGGCCGGCTGCCCGGCCGGCGGCGGGGGCGGCGCG
AACGCGCCGCTGGACGCGTCCACGCCGAACGCGTTCGACAACGCGTACTACGGCGACCTGGTCGCGCAGCAGGGGTTGCTGCACTCCGATCAAGAGCTCTTCAACGGCGGCTCCACGGAC
GGACTGGTCAGGAGCTACGCAGCCAGCTCGGCGCGGTTCAGTAGCGACTTCGCCGCTGCCATGGTCAAGATGGGCGGCATTGGTGTCATAACCGGGAGCAGCGGAGAGGTCCGGCGCAAC
TGCCGGAGGGTGAACTAG

Retrieve as FASTA