Entry information : SbPrx96 (Sobic.006G247800.1 [2.1] / SB06G031300 [1.4])
Entry ID 828
Creation 2006-01-02 (Christophe Dunand)
Last sequence changes 2011-01-18 (Toky Ramarohetra (Scipio))
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbPrx96 (Sobic.006G247800.1 [2.1] / SB06G031300 [1.4])
Name (synonym) SbPrx96 (Sobic.006G247800.1 [2.1] / SB06G031300 [1.4])
Class Class III peroxidase    [Orthogroup: Prx020]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx96
start..stop
S start..stop
ZmPrx04 625 0 1..337 1..332
SiPrx94 620 0 1..337 1..333
OsPrx58 615 0 1..337 1..337
BdiPrx134 592 0 11..337 16..342
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 59716909..59717151 243 N° 2 59716607..59716804 198 N° 3 59715192..59715357 166 N° 4 59713666..59714072 407
complement(join(59713666..59714072,59715192..59715357,59716607..59716804,5971690 9..59717151))


exon

Literature and cross-references SbPrx96 (Sobic.006G247800.1 [2.1] / SB06G031300 [1.4])
Literature Cordonnier-Pratt,M.-M. et al., unpublished
DNA ref. Phytozome 12:   chromosome_6 (59717151..59713666)
Protein sequence: SbPrx96 (Sobic.006G247800.1 [2.1] / SB06G031300 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   337
PWM (Da):   %s   35891.46 Transmb domain:   %s   i7-29o
PI (pH):   %s   9.45
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARAGGGGLLVFLLRGAALVTVAAVLLVGAARAAQLRQNYYGSSCPSAESTVRSVISQRLQQSFAVGPGTLRLFFHDCFVRGCDASVMLMAPNGDDESHSGADATLSPDAVDAINKAKAAVEALPGCAGKVSCADILAMAARDVVSLLGGPNYAVELGRLDGKTFNRAIVKHVLPGPGFNLDQLNSLFAQNGLTQTDMIALSGAHTIGVTHCDKFVRRIYTFKQRLAWNPPMNLDFLRSLRRVCPINYSPTAFAMLDVTTPKVFDNAYFNNLRYNKGLLASDQVLFTDRRSRPTVNVFAANSTAFYEAFIAAMAKLGRIGVKTGGDGEIRRVCTAVN

Retrieve as FASTA  
Remarks Complete sequence from Genomic (chromo 6, 3 introns) and 7 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAGAGCCGGCGGCGGTGGTCTCCTCGTCTTCCTCCTGCGCGGCGCGGCGCTGGTGACGGTGGCGGCCGTGCTGCTGGTGGGCGCGGCGAGGGCGGCGCAGCTGCGGCAGAACTAC
TACGGCAGCTCGTGCCCCAGCGCGGAGTCCACGGTCCGCTCCGTCATCTCGCAGCGCCTCCAGCAGAGCTTCGCCGTCGGGCCCGGAACGCTCCGCCTCTTCTTCCACGACTGCTTCGTC
AGA
GTAAGGCAGCTCGGGGGCGGGCATTGCCGTCCGTGCCTGTTCGTTCGTTCCTCCTCGATCTCAGCCCTGACGGAGCTAGCTTTTGGGGGGCATTGCATTTGCAGGGATGCGACGCGT
CGGTGATGCTGATGGCGCCCAACGGGGACGACGAGAGCCACAGCGGCGCGGACGCGACGCTGTCGCCGGACGCCGTGGACGCCATCAACAAGGCGAAGGCGGCCGTGGAGGCGCTCCCCG
GGTGCGCCGGCAAGGTCTCGTGCGCGGACATCCTCGCCATGGCCGCACGTGACGTCGTCTCCCTG
GTATGTATGGTAACCTTCATTCCTGCTCTCTCTCTCTCTCTTGTTGCTCCTCCTG
TCCTCCACCAAGCCAGCCATCCTACCGGTTTCACCGCGTCACGTACACGTAGGGCACGCCGGTGTCAGTGTCAGCGGCCAGGCACGCACGGGACCACGGTCGGTTCAAGTTCACCATCCC
CCGTCCCCGTTTTGTACTAGCATACAGTATGTTGTTTGTATCCCACCCAGACCCACCACGCCGTTCCGTCACTCTGATGGCAGGCGGGTCCCGGGGCACCGGTACTGTTCCAAGCCTGCG
TGCCAGTGACTTTTTTTTTCCTCGACGGCTGCAGCCGCAGCGGACTCGCGGTCCAGTCGCGCGGGGCGGGGCCGGGCCCTGCCCTGCACAGCGCGGCGCACCACGGCTGCACTGCACGGC
ACCACCCGGATTCGCCCGGAGGGACATGTGCTGCGTGTCAGCCGCCGCTGGCCCGCGCGGCCGCGGACGCCTCGCGTCGCCAAAGGGCGAAAGGCACCCGCGCCCCGCGCTGCCGTGTTC
CTGCGCGGTGGTGCCGCCTGCTGCCGGTGCCGCGCCTTGCACGGCGCCGTTGCTAGCATGCGCGGGCACCGACCGGGGCTTTGGGCTTGGCCCCTGCTGTCGAGACGACGGGCAACGGCT
TGGCTGGCTCGGTTCGGACAGAGACAGACCAGCAGCGGGCGCGAGTTGTTGAGACACTGACATGACATCACAGTAGGATACTATCAAGGACCATACTGGAGTTGTAACAGCAAAACCTCT
GTGCTCCTACTAGTACGGTAGCACTAGCACTAGCACCGGTGTAGTAGGGTGTTGCCTGCCCGTGACGCCCGGTGCTGTGGCCGAGCTAGCGTATAGTGAGTTTCCGTCACGTAGCTAAGC
TAGGTGTCCGTGACGCACTGACCACGGCCGAGACGCGACGATGTCCGCTCTTGCAAGCGTCTCGACTGTGAGAGGCCGGCAGGGGACAAAGTTTCCACTCCGTAGACTGTAGCCGGGGTG
CGGACAATTGTATAGCTTATTAGTAGTAGCAGTACAAGCTACTACTACTACTACTGATCGACTACTCCTCTACCACTTTACAGTCAAAAGAGCCCAAGTACTGTCGACCATGCATGCATG
CACACTACTCCTACCACACACTACAGAGCTGCCATGGAATACAGACGCTACCTTTTTCCTGCCAAACGAGAGAATTTCACCCTGCATTTCACATGCATTTTTTTTTCCCTGCAGTTGGGC
GGGCCGAACTACGCGGTGGAGCTGGGGCGGCTGGACGGCAAGACGTTCAACAGGGCCATCGTGAAGCACGTCCTCCCGGGCCCTGGCTTCAACCTGGACCAGCTCAACTCCCTCTTCGCC
CAGAACGGCCTCACGCAGACGGACATGATCGCCCTCTCAG
GTTCGTCCGTGCTCTCCTCTCCTCTGCTCACCCTGTCCTGTAACTGGTATTCCTCTCCACAGCACTGTCAAGACTATTGG
GCGTCTACGAATCATGAGGTCACACGACAACCTAGCTAGCCTGTCAATTAGATAACAGCTATATTAGATTAATTGTTGGAATGAATTAAACAATGCCTCCTCGATACTGTTTAGCAAGAA
CTACTGTGACAAGCTAGGGTTGATCGCAGTACAAAGCATCTTTCTCGTGCTCTCTGTGGCTCACGTGACTTTATCCTCTGTTTGCGGCGCCAAAGACAAAGTGGTTCGCTGTTCTATGCT
GCAACCCCTCTGTTCTTTTCGAAAAAAGCCGGAAAACCTTCTCCCGTCTTGTGTGATTTGGGAAAACCATCACGTACGTACTACACAATAGAAAAACACGAGCGCAGAGTACTCTGTGTT
GCAAGAAAGATTAAAAGAAAGAGGTGAGAAACCGACATAAAGTGGTAAAGTAATCACGCAATAACAGACGCCGGCCTACAGCTTTGCGAAAAGGTTAAACCCTGCTGGCTTCTGGTTCAT
TTCTAGGGAGGTTGATTTGGTTCGTATAAACAAAGATTATTCCTGGTGAACTTTTGAGGGGTTTTAGGTGTGTTGTTTACTGACCGTTGGGGTTTACATTATTTAGGCTCTCATGTTTTG
TTTTGTTTTTATCTTTGATTCGGTGTTGGGAATGATAAAAAACGACGTTTATAGTACATGAGAACAGGGGACACCTTTACCTTTGTCTGAATGTTCTTGGTTCCTGTCAGATCCCACTAG
TTAGCAGTAGTAAAATAACCTCTTGATCCAGATTTGAACACATGAAGCCTTTTCCCATCCAAACAAGCAGCAGTTACTTTTGACTGAACCACCCAATTTTGTCCATGCAAAGTTGGAGTA
GTACTGCTAGACTAGAAAGAATGGATGACTAACAAAAGAGCTAGCTCAGGACTTCAATTTCACAGGCTTTCATTTTTGAACACAAAATACGGATCAGAAATTCAGAACTGTGAACTGTGA
TAGTCTGTTTTTGCCACCCACCCATGCATTGTGAGGCATGTTAATCTAACCCAAGCTAGCAATGCACTACACACTGCAGGCGCGCACACGATCGGGGTGACGCACTGCGACAAGTTCGTT
CGGCGGATCTACACGTTCAAGCAGCGGCTGGCGTGGAACCCGCCGATGAACCTCGACTTCCTGCGGTCGCTGCGGCGGGTGTGTCCCATCAACTACAGCCCCACGGCGTTCGCCATGCTG
GACGTGACCACGCCCAAGGTCTTCGACAACGCCTACTTCAACAACCTCCGCTACAACAAGGGCCTGCTGGCGTCCGACCAGGTGCTCTTCACCGACCGCCGATCCAGACCCACCGTCAAC
GTCTTCGCCGCCAACAGCACCGCCTTCTACGAGGCCTTCATCGCCGCCATGGCCAAGCTCGGCAGGATCGGGGTCAAGACCGGCGGCGACGGCGAGATACGCCGCGTCTGCACCGCCGTC
AACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAGAGCCGGCGGCGGTGGTCTCCTCGTCTTCCTCCTGCGCGGCGCGGCGCTGGTGACGGTGGCGGCCGTGCTGCTGGTGGGCGCGGCGAGGGCGGCGCAGCTGCGGCAGAACTAC
TACGGCAGCTCGTGCCCCAGCGCGGAGTCCACGGTCCGCTCCGTCATCTCGCAGCGCCTCCAGCAGAGCTTCGCCGTCGGGCCCGGAACGCTCCGCCTCTTCTTCCACGACTGCTTCGTC
AGA
GGATGCGACGCGTCGGTGATGCTGATGGCGCCCAACGGGGACGACGAGAGCCACAGCGGCGCGGACGCGACGCTGTCGCCGGACGCCGTGGACGCCATCAACAAGGCGAAGGCGGCC
GTGGAGGCGCTCCCCGGGTGCGCCGGCAAGGTCTCGTGCGCGGACATCCTCGCCATGGCCGCACGTGACGTCGTCTCCCTG
TTGGGCGGGCCGAACTACGCGGTGGAGCTGGGGCGGCTG
GACGGCAAGACGTTCAACAGGGCCATCGTGAAGCACGTCCTCCCGGGCCCTGGCTTCAACCTGGACCAGCTCAACTCCCTCTTCGCCCAGAACGGCCTCACGCAGACGGACATGATCGCC
CTCTCAG
GCGCGCACACGATCGGGGTGACGCACTGCGACAAGTTCGTTCGGCGGATCTACACGTTCAAGCAGCGGCTGGCGTGGAACCCGCCGATGAACCTCGACTTCCTGCGGTCGCTG
CGGCGGGTGTGTCCCATCAACTACAGCCCCACGGCGTTCGCCATGCTGGACGTGACCACGCCCAAGGTCTTCGACAACGCCTACTTCAACAACCTCCGCTACAACAAGGGCCTGCTGGCG
TCCGACCAGGTGCTCTTCACCGACCGCCGATCCAGACCCACCGTCAACGTCTTCGCCGCCAACAGCACCGCCTTCTACGAGGCCTTCATCGCCGCCATGGCCAAGCTCGGCAGGATCGGG
GTCAAGACCGGCGGCGACGGCGAGATACGCCGCGTCTGCACCGCCGTCAACTAG

Retrieve as FASTA