Entry information : SbPrx43 (Sobic.002G392100.1 [2.1] / SB02G040750 [1.4])
Entry ID 829
Creation 2006-01-03 (Christophe Dunand)
Last sequence changes 2006-01-03
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbPrx43 (Sobic.002G392100.1 [2.1] / SB02G040750 [1.4])
Name (synonym) SbPrx43 (Sobic.002G392100.1 [2.1] / SB02G040750 [1.4])
Class Class III peroxidase    [Orthogroup: Prx096]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue types Roots
Seedlings
Inducers Acid treatment
Alkaline treatment
Salt stress
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx43
start..stop
S start..stop
SbPrx42 561 0 4..364 1..360
ZmPrx79 540 0 66..364 63..362
SiPrx143 482 2e-172 67..364 49..347
SiPrx119 481 6e-172 6..364 7..355
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 74645083..74645418 336 N° 2 74644215..74644973 759  
complement(join(74644215..74644973,74645083..74645418))


exon

Literature and cross-references SbPrx43 (Sobic.002G392100.1 [2.1] / SB02G040750 [1.4])
Literature Cordonnier-Pratt,M.-M. et al., unpublished
DNA ref. Phytozome 11:   chromosome_2 (74645418..74644215)
Protein sequence: SbPrx43 (Sobic.002G392100.1 [2.1] / SB02G040750 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   364 (341)
PWM (Da):   %s   38758.85 (36523.6) Transmb domain:   %s   i7-29o
PI (pH):   %s   9.26 (9.08) Peptide Signal:   %s   cut: 24 range:24-364
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQKMAGLAVLVLVALLAAATAQAQGSYGYGKSPAPAASPPESAPMPPPSSSPPTQTPPPPASPRTRLRFDFYKRSCPYAEEIVREAVRNAINVNPGLGAGLIRMAFHDCFVQGCDGSVLLDPTPANPRPEKLSPANFPSLRGFDVVDAAKAALEKACPGVVSCADVVQFAARDAAFFLSGSKIHYSLPGGRLDGRVSVENETFAFLPGPSFNLSRLIQSFKVKGLSVDDLVVLSGAHTIGLSHCSSFLTVSTPPSDMNPGLAAVLKKQCPANPNFTNDPTVVQDVVTPDKLDNQYYWNVLRHKVLFKSDAALMASTQTARMVLENAGIRGRFERKFARAMLKMSFIEVKNAANGEIRKSCHVAN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, intron 1) and 7 ESTs (TC93355, GRRD is missing), from 7 ESTs (TC93354, missing sequence between FDN and AM-KG), from 2 ESTs (TC93359, GRRD and VALS are missing). .
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGAAGATGGCCGGACTTGCCGTCCTCGTCTTGGTTGCGTTGCTCGCCGCCGCCACTGCTCAAGCCCAAGGGTCCTACGGCTATGGCAAATCTCCTGCTCCTGCAGCAAGCCCGCCG
GAGAGCGCCCCCATGCCGCCGCCGAGCTCAAGCCCACCAACCCAGACTCCTCCACCTCCGGCTTCTCCTCGGACAAGGCTGAGGTTCGACTTCTACAAGCGGTCGTGCCCTTACGCCGAG
GAAATCGTCAGGGAGGCCGTCAGGAACGCCATCAACGTCAACCCCGGCCTCGGCGCCGGCCTCATCCGCATGGCCTTCCACGACTGCTTCGTCCAG
GTACGTGAATCCCAAGGCTAGCAA
GCTGCCAAAATTTGGCCGTGCATGCATGCAAAATGCATTGCCAATTGATGCGCGACCGCCACTTATTTGTTGTTGCATCTATCAGGGCTGCGACGGCTCAGTGCTGCTCGACCCGACGCC
GGCGAACCCACGGCCGGAGAAGCTCAGCCCGGCAAACTTCCCCAGCCTGCGTGGCTTCGACGTGGTGGACGCGGCCAAGGCGGCGCTCGAGAAGGCCTGCCCAGGCGTCGTCTCCTGCGC
CGACGTCGTCCAGTTCGCCGCCCGCGACGCCGCCTTCTTCCTCAGCGGCTCCAAGATCCACTACAGCCTCCCTGGGGGACGCTTGGACGGCCGCGTGTCCGTGGAGAACGAGACGTTCGC
CTTCCTGCCGGGGCCGTCCTTCAACCTCTCCCGGCTCATCCAGAGCTTCAAGGTCAAAGGCCTGAGCGTCGACGACCTCGTCGTGCTCTCCGGCGCCCACACCATCGGCCTCTCCCACTG
CTCCTCCTTCCTCACCGTCTCCACGCCGCCGTCCGACATGAACCCTGGCCTCGCCGCCGTACTCAAGAAGCAGTGCCCGGCCAACCCCAACTTCACCAACGACCCCACGGTGGTGCAGGA
CGTCGTCACCCCCGACAAGCTCGACAACCAGTACTACTGGAACGTGCTGCGTCACAAGGTGCTGTTCAAATCCGACGCGGCGCTGATGGCGTCGACGCAGACGGCGAGGATGGTGCTCGA
GAACGCTGGCATCCGAGGAAGGTTTGAGAGGAAGTTCGCCCGGGCGATGCTCAAGATGTCGTTCATCGAGGTCAAGAACGCTGCCAACGGCGAGATCAGGAAGAGCTGCCATGTCGCCAA
CTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGAAGATGGCCGGACTTGCCGTCCTCGTCTTGGTTGCGTTGCTCGCCGCCGCCACTGCTCAAGCCCAAGGGTCCTACGGCTATGGCAAATCTCCTGCTCCTGCAGCAAGCCCGCCG
GAGAGCGCCCCCATGCCGCCGCCGAGCTCAAGCCCACCAACCCAGACTCCTCCACCTCCGGCTTCTCCTCGGACAAGGCTGAGGTTCGACTTCTACAAGCGGTCGTGCCCTTACGCCGAG
GAAATCGTCAGGGAGGCCGTCAGGAACGCCATCAACGTCAACCCCGGCCTCGGCGCCGGCCTCATCCGCATGGCCTTCCACGACTGCTTCGTCCAG
GGCTGCGACGGCTCAGTGCTGCTC
GACCCGACGCCGGCGAACCCACGGCCGGAGAAGCTCAGCCCGGCAAACTTCCCCAGCCTGCGTGGCTTCGACGTGGTGGACGCGGCCAAGGCGGCGCTCGAGAAGGCCTGCCCAGGCGTC
GTCTCCTGCGCCGACGTCGTCCAGTTCGCCGCCCGCGACGCCGCCTTCTTCCTCAGCGGCTCCAAGATCCACTACAGCCTCCCTGGGGGACGCTTGGACGGCCGCGTGTCCGTGGAGAAC
GAGACGTTCGCCTTCCTGCCGGGGCCGTCCTTCAACCTCTCCCGGCTCATCCAGAGCTTCAAGGTCAAAGGCCTGAGCGTCGACGACCTCGTCGTGCTCTCCGGCGCCCACACCATCGGC
CTCTCCCACTGCTCCTCCTTCCTCACCGTCTCCACGCCGCCGTCCGACATGAACCCTGGCCTCGCCGCCGTACTCAAGAAGCAGTGCCCGGCCAACCCCAACTTCACCAACGACCCCACG
GTGGTGCAGGACGTCGTCACCCCCGACAAGCTCGACAACCAGTACTACTGGAACGTGCTGCGTCACAAGGTGCTGTTCAAATCCGACGCGGCGCTGATGGCGTCGACGCAGACGGCGAGG
ATGGTGCTCGAGAACGCTGGCATCCGAGGAAGGTTTGAGAGGAAGTTCGCCCGGGCGATGCTCAAGATGTCGTTCATCGAGGTCAAGAACGCTGCCAACGGCGAGATCAGGAAGAGCTGC
CATGTCGCCAACTAG

Retrieve as FASTA