Entry information : SbPrx46 (Sobic.002G416600.1 [2.1] / SB02G042850 [1.4])
Entry ID 830
Creation 2010-01-07 (Christophe Dunand)
Last sequence changes 2011-01-18 (Toky Ramarohetra (Scipio))
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbPrx46 (Sobic.002G416600.1 [2.1] / SB02G042850 [1.4])
Name (synonym) SbPrx46 (Sobic.002G416600.1 [2.1] / SB02G042850 [1.4])
Class Class III peroxidase    [Orthogroup: Prx059]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue type Roots
Inducers Acid treatment
Alkaline treatment
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx46
start..stop
S start..stop
ZmPrx06 546 0 22..319 23..320
SiPrx120 533 0 3..319 42..351
CciPrx02 518 0 3..319 2..313
OsPrx112 466 2e-167 26..319 28..314
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 76590923..76591126 204 N° 2 76591315..76591512 198 N° 3 76591637..76592194 558  
join(76590923..76591126,76591315..76591512,76591637..76592194)


exon

Literature and cross-references SbPrx46 (Sobic.002G416600.1 [2.1] / SB02G042850 [1.4])
Literature Cordonnier-Pratt,M.-M. et al., unpublished
DNA ref. Phytozome 12:   chromosome_2 (76590923..76592194)
Protein sequence: SbPrx46 (Sobic.002G416600.1 [2.1] / SB02G042850 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   319 (298)
PWM (Da):   %s   33236.44 (31230.4)  
PI (pH):   %s   6.97 (6.98) Peptide Signal:   %s   cut: 22 range:22-319
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASSSVSALLLFLCLAAVASAQLSPTFYDTSCPNALSTIKSAVNAAVQKENRMGASLLRLHFHDCFVQGCDASVLLADNAATGFTGEQGALPNAGSLRGFDVIANIKTQVEAICKQTVSCADILAVAARDSVVALGGPSWTVPLGRRDSTTASLSLANSDLPPPSFNLEQLIKAFGNKGFTATEMATLSGAHTIGQAQCQFFRDHIYNDTNINSAFATSLKANCPRSTGSGDGNLAPLDTTTPYKFDNAYYSNLLNQKGLLHSDQELFNGGSTDNTVRNFASNSAAFSSAFAAAMVKMGNLSPLTGSQGQIRLTCSKVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, introns 1 and 2) and 2 ESTs. Cultivar="BTx623"
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCTTCTTCGGTGTCAGCCTTGCTGCTCTTTCTGTGCTTGGCCGCGGTGGCGTCAGCGCAGCTCTCGCCGACGTTTTACGACACGTCGTGCCCCAACGCGCTGTCCACCATCAAG
AGCGCCGTGAACGCCGCCGTGCAGAAGGAGAACCGCATGGGGGCCTCCTTGCTCAGGCTGCACTTCCACGACTGCTTTGTCCAG
GCAAGTTCATTCCCTTTCTCGATCACCTTCAGCTTC
ATTTGCCTCACGTTGGTTAATTTCATGCAATTTATTAGGCAAGTTCATTCCCTTTCTCGATCACCAGACCACAATCATGTGCCTAACTTTCGTTACTGTTCTAACAAAACAATAATCGCT
GCATTTGAATGCGTGTGATGACATGATATCAGGGGTGCGACGCGTCGGTGCTGCTGGCCGACAACGCCGCCACGGGCTTCACCGGCGAGCAGGGGGCGTTACCCAACGCGGGGTCTCTGA
GGGGCTTCGACGTCATCGCCAACATCAAGACGCAGGTGGAGGCCATCTGCAAGCAGACCGTCTCCTGTGCCGACATCCTCGCCGTCGCCGCCCGGGACTCTGTCGTCGCG
GTAAGCAAGC
CGCCGGCCGGCAACGATCGCCGCCTCATCGATCGATCGATATCGTCATGCATGCAACAAATGAGGCTGGATTCGTCATCCCTTTCCCTTACCTCGATCGCGCTCGTGCATGCAGTTGGGA
GGGCCGTCATGGACGGTTCCTCTGGGTCGGAGAGACTCGACGACGGCGAGCCTGTCCCTGGCGAACAGCGACCTGCCGCCGCCCTCCTTCAACCTCGAACAGCTCATAAAAGCGTTCGGC
AACAAGGGTTTCACCGCGACGGAGATGGCCACGCTCTCTGGCGCGCACACCATCGGGCAGGCGCAGTGCCAGTTCTTCAGGGATCACATCTACAACGACACCAACATCAACTCCGCGTTC
GCGACCTCGCTCAAGGCCAACTGCCCCCGTTCCACCGGCTCCGGCGACGGCAACCTGGCGCCGCTCGACACCACCACGCCGTACAAGTTCGACAACGCCTACTACAGCAACCTACTGAAC
CAGAAGGGGCTCCTGCACTCGGACCAAGAGCTCTTCAATGGCGGCAGCACCGACAACACCGTCAGGAACTTCGCGTCCAACTCGGCGGCCTTCAGCAGCGCCTTCGCCGCGGCCATGGTG
AAGATGGGCAACCTCAGCCCGCTCACCGGCTCCCAGGGCCAGATCAGACTCACCTGCTCCAAAGTGAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCTTCTTCGGTGTCAGCCTTGCTGCTCTTTCTGTGCTTGGCCGCGGTGGCGTCAGCGCAGCTCTCGCCGACGTTTTACGACACGTCGTGCCCCAACGCGCTGTCCACCATCAAG
AGCGCCGTGAACGCCGCCGTGCAGAAGGAGAACCGCATGGGGGCCTCCTTGCTCAGGCTGCACTTCCACGACTGCTTTGTCCAG
GGGTGCGACGCGTCGGTGCTGCTGGCCGACAACGCC
GCCACGGGCTTCACCGGCGAGCAGGGGGCGTTACCCAACGCGGGGTCTCTGAGGGGCTTCGACGTCATCGCCAACATCAAGACGCAGGTGGAGGCCATCTGCAAGCAGACCGTCTCCTGT
GCCGACATCCTCGCCGTCGCCGCCCGGGACTCTGTCGTCGCG
TTGGGAGGGCCGTCATGGACGGTTCCTCTGGGTCGGAGAGACTCGACGACGGCGAGCCTGTCCCTGGCGAACAGCGAC
CTGCCGCCGCCCTCCTTCAACCTCGAACAGCTCATAAAAGCGTTCGGCAACAAGGGTTTCACCGCGACGGAGATGGCCACGCTCTCTGGCGCGCACACCATCGGGCAGGCGCAGTGCCAG
TTCTTCAGGGATCACATCTACAACGACACCAACATCAACTCCGCGTTCGCGACCTCGCTCAAGGCCAACTGCCCCCGTTCCACCGGCTCCGGCGACGGCAACCTGGCGCCGCTCGACACC
ACCACGCCGTACAAGTTCGACAACGCCTACTACAGCAACCTACTGAACCAGAAGGGGCTCCTGCACTCGGACCAAGAGCTCTTCAATGGCGGCAGCACCGACAACACCGTCAGGAACTTC
GCGTCCAACTCGGCGGCCTTCAGCAGCGCCTTCGCCGCGGCCATGGTGAAGATGGGCAACCTCAGCCCGCTCACCGGCTCCCAGGGCCAGATCAGACTCACCTGCTCCAAAGTGAACTAA

Retrieve as FASTA