Entry information : SbPrx42 (Sobic.002G392000.1 [2.1] / SB02G040740 [1.4])
Entry ID 831
Creation 2006-01-02 (Christophe Dunand)
Last sequence changes 2006-01-02
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbPrx42 (Sobic.002G392000.1 [2.1] / SB02G040740 [1.4])
Name (synonym) SbPrx42 (Sobic.002G392000.1 [2.1] / SB02G040740 [1.4])
Class Class III peroxidase    [Orthogroup: Prx098]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue types Leaves
Roots
Inducer Oxidative stress
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx42
start..stop
S start..stop
SbPrx43 559 0 60..360 64..364
ZmPrx79 535 0 62..360 63..362
SiPrx143 498 2e-178 1..360 1..347
SiPrx119 483 2e-172 4..360 8..355
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 74638299..74638622 324 N° 2 74638725..74639483 759  
join(74638299..74638622,74638725..74639483)


exon

Literature and cross-references SbPrx42 (Sobic.002G392000.1 [2.1] / SB02G040740 [1.4])
Literature Cordonnier-Pratt,M.-M. et al., unpublished
DNA ref. Phytozome 11:   chromosome_2 (74638299..74639483)
Protein sequence: SbPrx42 (Sobic.002G392000.1 [2.1] / SB02G040740 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   360 (340)
PWM (Da):   %s   38480.96 (36577.8)  
PI (pH):   %s   9.05 (8.88) Peptide Signal:   %s   cut: 21 range:21-360
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARLGVIVLVALLAAAAAQAQGSYGSGYAVPALSLESAPVPPPISSPPPAQTPPPPASARPKLRFDFYKRSCPYAEEIVREAVRNATNVNPGLGAGLIRMAFHDCFVQGCDGSVLLDPTPANPRPEKLSPANFPSLRGFDVVDAAKAALEKACPGVVSCADVVQFAARDAAFFLSGSKVYYSLPGGRFDGRVSFENETFTFLPPPSFNLSELIQNFKVKGLNVDDLVVLSGAHTIGLSHCSSFLSISTPPSDMNPGLATVLKKQCPAKPNFTNDPTVVQDVVTPDKLDNQYYRNVLHHKVLFKSDAALLNSTETAKKVAENALIRGRWERKFAKAMLKMSLLDIKTAANGEIRKKCHVVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, intron 1) and 2 ESTs (TC93356, VALS is missing) and from 5 ESTs (TC93357, sequence is missing between CP and GEIR).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAGGCTTGGCGTCATCGTCTTGGTTGCCCTGCTCGCCGCCGCCGCCGCTCAAGCGCAAGGGTCCTACGGCAGTGGCTATGCTGTTCCTGCATTAAGCTTGGAGAGCGCCCCCGTG
CCGCCGCCGATCTCAAGCCCACCACCAGCCCAGACTCCACCACCACCGGCTTCAGCTCGGCCAAAGCTGAGGTTCGACTTCTACAAGCGGTCGTGCCCTTACGCCGAGGAAATCGTCAGG
GAGGCCGTGAGGAACGCCACCAATGTCAACCCCGGCCTCGGCGCCGGCCTCATCCGCATGGCCTTCCATGACTGCTTCGTCCAG
GTACGTGTTTCCCGATGCTAGCTTCCAAAATTTGGG
CCGTGCATGGATGCAAATGCACTGCCTTGATGCCCGACCACCACGTATTTGTTGTTGCATCGTCAGGGCTGCGACGGCTCAGTTCTGCTCGACCCGACGCCGGCGAACCCGCGGCCGGAG
AAGCTCAGCCCGGCAAACTTCCCCAGCCTGCGCGGCTTCGACGTGGTGGACGCGGCCAAGGCGGCGCTCGAGAAGGCCTGCCCGGGCGTCGTCTCCTGCGCCGACGTCGTCCAGTTCGCC
GCCCGCGACGCCGCCTTCTTCCTTAGCGGCTCCAAGGTCTACTACAGCCTCCCCGGGGGACGCTTCGACGGCCGCGTGTCCTTCGAGAACGAGACGTTCACCTTCCTGCCACCGCCGTCC
TTCAACCTCTCCGAGCTCATCCAGAACTTCAAGGTCAAGGGCCTGAACGTCGACGACCTCGTCGTGCTCTCCGGCGCCCACACCATCGGCCTCTCCCACTGCTCGTCCTTCCTCAGCATC
TCCACGCCGCCGTCCGACATGAACCCTGGCCTCGCCACCGTACTCAAGAAGCAGTGCCCGGCCAAGCCCAATTTCACCAACGACCCCACGGTGGTGCAGGACGTCGTCACCCCCGACAAG
CTGGACAACCAGTACTACCGGAACGTGCTACATCACAAGGTGCTGTTCAAGTCCGATGCGGCCCTTCTCAACTCGACGGAGACGGCGAAGAAGGTGGCCGAGAACGCCTTGATCCGTGGG
AGGTGGGAGAGGAAGTTCGCCAAGGCGATGCTGAAGATGTCGCTCCTCGACATCAAGACTGCCGCCAACGGAGAGATCCGGAAGAAGTGCCACGTCGTCAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAGGCTTGGCGTCATCGTCTTGGTTGCCCTGCTCGCCGCCGCCGCCGCTCAAGCGCAAGGGTCCTACGGCAGTGGCTATGCTGTTCCTGCATTAAGCTTGGAGAGCGCCCCCGTG
CCGCCGCCGATCTCAAGCCCACCACCAGCCCAGACTCCACCACCACCGGCTTCAGCTCGGCCAAAGCTGAGGTTCGACTTCTACAAGCGGTCGTGCCCTTACGCCGAGGAAATCGTCAGG
GAGGCCGTGAGGAACGCCACCAATGTCAACCCCGGCCTCGGCGCCGGCCTCATCCGCATGGCCTTCCATGACTGCTTCGTCCAG
GGCTGCGACGGCTCAGTTCTGCTCGACCCGACGCCG
GCGAACCCGCGGCCGGAGAAGCTCAGCCCGGCAAACTTCCCCAGCCTGCGCGGCTTCGACGTGGTGGACGCGGCCAAGGCGGCGCTCGAGAAGGCCTGCCCGGGCGTCGTCTCCTGCGCC
GACGTCGTCCAGTTCGCCGCCCGCGACGCCGCCTTCTTCCTTAGCGGCTCCAAGGTCTACTACAGCCTCCCCGGGGGACGCTTCGACGGCCGCGTGTCCTTCGAGAACGAGACGTTCACC
TTCCTGCCACCGCCGTCCTTCAACCTCTCCGAGCTCATCCAGAACTTCAAGGTCAAGGGCCTGAACGTCGACGACCTCGTCGTGCTCTCCGGCGCCCACACCATCGGCCTCTCCCACTGC
TCGTCCTTCCTCAGCATCTCCACGCCGCCGTCCGACATGAACCCTGGCCTCGCCACCGTACTCAAGAAGCAGTGCCCGGCCAAGCCCAATTTCACCAACGACCCCACGGTGGTGCAGGAC
GTCGTCACCCCCGACAAGCTGGACAACCAGTACTACCGGAACGTGCTACATCACAAGGTGCTGTTCAAGTCCGATGCGGCCCTTCTCAACTCGACGGAGACGGCGAAGAAGGTGGCCGAG
AACGCCTTGATCCGTGGGAGGTGGGAGAGGAAGTTCGCCAAGGCGATGCTGAAGATGTCGCTCCTCGACATCAAGACTGCCGCCAACGGAGAGATCCGGAAGAAGTGCCACGTCGTCAAC
TAG

Retrieve as FASTA