Entry information : SbPrx141 (Sobic.010G245400.1 [2.1] / SB10G028470 [1.4])
Entry ID 832
Creation 2010-01-07 (Christophe Dunand)
Last sequence changes 2010-01-07 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbPrx141 (Sobic.010G245400.1 [2.1] / SB10G028470 [1.4])
Name (synonym) SbPrx141 (Sobic.010G245400.1 [2.1] / SB10G028470 [1.4])
Class Class III peroxidase    [Orthogroup: Prx096]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue type Roots
Inducers Acid treatment
Alkaline treatment
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx141
start..stop
S start..stop
ZmPrx133 608 0 1..320 1..320
SiPrx36 550 0 1..320 1..318
SiPrx35 525 0 1..320 1..319
SbPrx142 521 0 5..320 3..318
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 58278300..58278524 225 N° 2 58278611..58278808 198 N° 3 58278922..58279081 160 N° 4 58279239..58279618 380
join(58278300..58278524,58278611..58278808,58278922..58279081,58279239..58279618 )


exon

Literature and cross-references SbPrx141 (Sobic.010G245400.1 [2.1] / SB10G028470 [1.4])
Literature Cordonnier-Pratt, M.-M. et al., unpublished.
DNA ref. Phytozome 12:   chromosome_10 (58278300..58279618)
Protein sequence: SbPrx141 (Sobic.010G245400.1 [2.1] / SB10G028470 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   320 (292)
PWM (Da):   %s   34124.58 (31472.1)  
PI (pH):   %s   4.94 (4.81) Peptide Signal:   %s   cut: 29 range:29-320
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASGRLSFVVVVAALVASAGLMPPSAVAELKTDYYASTCPNLEVIVRSSVKQSMAQSPISAPAALRLFFHDCAVRGCDASIMIVNSNGDDEWRNSDNQSLKPEGFQTILNAKAAVDSDPQCQYKVSCADIMAIAARESVYQSGGPYYEVELGRYDGRVSTRDGVVLPHANFNLDQLNAFFSGLGFSQAEMVALSGAHTLGAADCPFFQYRIGSDATMDPGFASQLKDTCSSDPNAFAFLDPSPVGFDNAFYRNLQGGKGLLGSDQVLYSDTRSRGTVNYYASNQGAFFADFVAAMTKLGRIGVKTPATGGEIRRDCRFPN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 10, 3 introns) and 2 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAGTGGTCGGTTGAGCTTCGTCGTCGTCGTGGCCGCCCTCGTCGCGTCCGCGGGTCTCATGCCGCCGTCTGCCGTCGCCGAGCTGAAGACAGACTACTATGCCAGCACCTGCCCT
AACCTGGAGGTCATCGTCCGGAGCTCCGTGAAGCAGTCCATGGCGCAGTCACCCATCTCCGCGCCCGCCGCGCTCAGGCTCTTCTTCCACGATTGCGCCGTCAGG
GTACGTCGTAATATA
CGTTATACTACTCGCCGGACACGGCCAGGATCTGATCCAGCCGGCCGGCCGGGGTATGTTTTGTACGACAGGGCTGCGACGCGTCGATCATGATCGTGAACTCCAACGGCGACGACGAGT
GGCGGAACAGCGACAACCAGTCGCTCAAGCCGGAGGGGTTTCAGACCATCCTGAACGCCAAGGCCGCCGTGGACAGCGACCCGCAATGCCAGTACAAGGTTTCCTGCGCCGACATCATGG
CCATCGCAGCCAGAGAATCCGTCTACCAG
GTATTGCGTGCTACCGATCGACAGAGAAATCACCCATATACTATATGCAAAAATGCACTGCCGCCAGAGACAATACCATTTTCAGTTACAC
GCATGCATTGGTTTCTCATCAGAGCGGCGGGCCGTACTACGAGGTGGAGTTGGGACGGTACGACGGCCGGGTGTCCACCAGGGACGGCGTCGTGCTGCCGCATGCCAACTTCAACCTCGA
CCAGCTCAACGCCTTCTTCTCCGGCCTCGGCTTCTCCCAGGCTGAAATGGTCGCGCTGTCAG
GTAAACGACGACGACTACTGCTCACGTACACGTCACAATCCACCTCACTCTCGCTTGA
ATAATTGTCCTGCACTCTGTGTGCCATGCACGTCGTCGTCGACATGAGATGCCAGCCTGACCACGTACGCCATACTTGCCTTGTGCGTGAATTATTCAGGCGCCCACACCCTCGGCGCCG
CGGACTGCCCCTTCTTCCAGTACAGGATCGGCAGCGACGCGACCATGGACCCCGGCTTCGCGTCGCAGCTGAAAGACACCTGCAGCTCCGACCCCAACGCCTTCGCCTTCCTCGACCCGT
CGCCGGTGGGCTTCGACAACGCCTTCTACCGGAACCTGCAGGGCGGCAAGGGGCTCCTGGGCTCCGATCAGGTGCTCTACTCCGACACGAGGTCCCGCGGCACGGTCAACTACTACGCGT
CCAACCAGGGCGCCTTCTTCGCCGACTTCGTGGCGGCGATGACAAAGCTCGGGAGGATAGGGGTCAAGACGCCCGCCACCGGCGGCGAGATACGCCGGGACTGCCGGTTCCCGAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAGTGGTCGGTTGAGCTTCGTCGTCGTCGTGGCCGCCCTCGTCGCGTCCGCGGGTCTCATGCCGCCGTCTGCCGTCGCCGAGCTGAAGACAGACTACTATGCCAGCACCTGCCCT
AACCTGGAGGTCATCGTCCGGAGCTCCGTGAAGCAGTCCATGGCGCAGTCACCCATCTCCGCGCCCGCCGCGCTCAGGCTCTTCTTCCACGATTGCGCCGTCAGG
GGCTGCGACGCGTCG
ATCATGATCGTGAACTCCAACGGCGACGACGAGTGGCGGAACAGCGACAACCAGTCGCTCAAGCCGGAGGGGTTTCAGACCATCCTGAACGCCAAGGCCGCCGTGGACAGCGACCCGCAA
TGCCAGTACAAGGTTTCCTGCGCCGACATCATGGCCATCGCAGCCAGAGAATCCGTCTACCAG
AGCGGCGGGCCGTACTACGAGGTGGAGTTGGGACGGTACGACGGCCGGGTGTCCACC
AGGGACGGCGTCGTGCTGCCGCATGCCAACTTCAACCTCGACCAGCTCAACGCCTTCTTCTCCGGCCTCGGCTTCTCCCAGGCTGAAATGGTCGCGCTGTCAG
GCGCCCACACCCTCGGC
GCCGCGGACTGCCCCTTCTTCCAGTACAGGATCGGCAGCGACGCGACCATGGACCCCGGCTTCGCGTCGCAGCTGAAAGACACCTGCAGCTCCGACCCCAACGCCTTCGCCTTCCTCGAC
CCGTCGCCGGTGGGCTTCGACAACGCCTTCTACCGGAACCTGCAGGGCGGCAAGGGGCTCCTGGGCTCCGATCAGGTGCTCTACTCCGACACGAGGTCCCGCGGCACGGTCAACTACTAC
GCGTCCAACCAGGGCGCCTTCTTCGCCGACTTCGTGGCGGCGATGACAAAGCTCGGGAGGATAGGGGTCAAGACGCCCGCCACCGGCGGCGAGATACGCCGGGACTGCCGGTTCCCGAAC
TAG

Retrieve as FASTA