Entry information : BrAPx-R-1Aa_other (Bra023954 )
Entry ID 8354
Creation 2011-04-29 (Christophe Dunand)
Last sequence changes 2011-04-29 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-07-20 (Christophe Dunand)
Peroxidase information: BrAPx-R-1Aa_other (Bra023954 )
Name (synonym) BrAPx-R-1Aa_other (Bra023954 )
Class Ascorbate peroxidase related    [Orthogroup: APx-R001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Brassica
Organism Brassica rapa    [TaxId: 3711 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BrAPx-R-1Aa_other
start..stop
S start..stop
BnAPx-R-1_other 645 0 3..327 2..325
BoAPx-R-1Ca_other 644 0 3..327 2..325
AlyAPx-R 557 0 3..327 2..329
AtAPx-R 554 0 3..327 2..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..175 175 N° 2 319..421 103 N° 3 514..629 116 N° 4 713..783 71
N° 5 1047..1089 43 N° 6 1161..1257 97 N° 7 1327..1410 84 N° 8 1487..1611 125
N° 9 1691..1757 67 N° 10 1879..1981 103  
join(1..175,319..421,514..629,713..783,1047..1089,1161..1257,1327..1410,1487..16 11,1691..1757,1879..1981)


exon

Literature and cross-references BrAPx-R-1Aa_other (Bra023954 )
DNA ref. GenBank:   AC241083.1 (13147..11167)
Protein sequence: BrAPx-R-1Aa_other (Bra023954 )
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327
PWM (Da):   %s   35993.26  
PI (pH):   %s   8.47
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTTTTTASLFSRCHSSSSLNFKCELESPAKTRLFSPATGRHVVRSLKACRIRCSSSDPSSRHVFVSSRRQMAVLLSTVQLLSHWLPPDGKAADMYPLMKDEIRRVVTKGKAAGVLRLVFHDAGTFELDDNGGINGSIVYELERPENAGLKRSLVLEKAKIKVDEIQPVSWADMIAVGGSEAVSMCGGPTIPVVLGRLDSMQPDPEDKLPPESLNASGLKECFQRKGFSTQELVALSGAHTIGSKGFGDPFTFDNAYYKILLEKPWRSTSKMTSMVGLPSDHALVEDDECLRWVKEYAEDQDKFFRDFTNAYIKLVNSGAKWKTL

Retrieve as FASTA  
Remarks Complete sequence from genomic (9 introns). No EST. Incorrect prediction from Phytozome (missing exon).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACGACGACGACTACTGCGTCTCTGTTTTCTCGGTGCCACTCTTCTTCTTCTTTAAACTTCAAATGCGAACTCGAATCTCCCGCGAAAACGCGACTGTTCTCTCCGGCGACAGGGAGA
CATGTTGTCCGATCGTTAAAAGCATGTCGTATCCGTTGCTCCTCCAGTGATCCTA
GTAAGACATGGCTTTAGTTTCTCTTGACGTTATTACTGATCATACTGAGAGATGTGTTCTGTCTC
TTCATGATTTGACTAGACTGTGTTCTGTTTCTAGATGATTTGACTAGGTTATGTTCTGTTTCTGCATGTTTTGACTAGGTTCACGTCATGTATTCGTGTCCAGTAGAAGACAAATGGCTG
TCTTGTTATCCACTGTACAGCTTCTGTCTCATTGGCTTCCCCCTGATGGAAAGGCAGCTGA
GTGAGTTTGAGGCAAAACTATTCTTCATGTTATAGTTTTAAATTTATTGTGCTAGGTTT
TTAGCCAAATCTGACTGTTGGGTTTCACTTCAGCATGTATCCACTGATGAAAGACGAGATAAGGAGAGTGGTGACGAAGGGTAAAGCTGCTGGTGTGCTTCGTTTAGTGTTTCATGATGC
TGGAACCTTTGAACTTGATGATAACACAG
GTAGTAGTGTTGCCATGACTCTCTGATATATACTAATCGATCTCATTCTCAAAATCTTACTTAAGTGTTGTGTGTAATTTCAGGTGGCATC
AATGGGTCTATTGTTTATGAACTGGAAAGACCTGAAAACGCAGGTTTGAAGAGATCTCTAAAG
GCACTAAACCCTCTCTATCTCTCTCTTTTTAGTTAGTGTGAGCATGGCCTGTCTTGA
GCATAGGCTAGTAAAGCATTGGTCTATGTCCCCAAAAATTTTAGGAAAAATTTATATATATATAACCCCTAAGTTTGCAAAATAAACTTTTTTTATATAAACTATTTCTAAATTGTTTAT
AGTCCCAAAATCTTAGGACCTGCCCTGAGTGTGAGCAAATAAAGATGTAATTTCACATATGTTTTTTTTTTTTTGGCATTTGTTAGGTTCTAGAGAAAGCAAAGATTAAGGTTGATGAGA
TACAACCAG
GTAATTTCTGTTTGAAAGTGTGTCCTTGTTATGCCTTCGTGGTGCTAACGTTCTGAACTGTGTGATGTTAGTGTCTTGGGCCGATATGATCGCTGTTGGTGGCTCTGAAGC
AGTCTCAATGTGCGGCGGCCCAACAATTCCAGTAGTTTTAGGAAGACTTGATTCAAT
GTAAGCACGTCTCAGTCTCTGGTCTTTGTTTCTATATGTTTAACAGGATGGTCGTTTCATGGT
TTACAGGCAACCTGATCCAGAAGACAAGTTACCTCCAGAATCCCTCAATGCCTCGGGTTTAAAAGAATGTTTCCAAAGAAAAGGATTCTCGTGAGTCATAACTTGTGGTTTCTTTAGTAC
CAAAGTTTTGTAACACTTAACATCACTTGGGGGGGGGTCATTGCAGGACCCAAGAACTTGTTGCCTTATCTGGTGCACATACGATTGGGAGTAAAGGCTTTGGAGATCCATTTACTTTTG
ACAATGCATACTACAAAATCCTTCTTGAAAAACCTTGGAGATCTACTACAT
GTAAGTTGTTATACTCTAAGCTGAGGAGTGTATCTTTACATAGTTTTCTTAATTTATCATGACTTTATT
TGGGTTGCAGCCAAAATGACGAGTATGGTTGGGCTTCCTTCGGATCATGCCCTCGTGGAGGATGATGAGTGCTTAAGGTCCGTCCTTCTTACTTTGATCATTTCATTATCTAACTTGTCA
AGTAGCATTTGAAGCAGAGGCTGAAGAGTTTTGGAGTATATATTCAACTGATATTAAGATTCAATGTTTGATGCATAGGTGGGTGAAAGAGTATGCGGAAGACCAAGACAAGTTCTTCAG
AGACTTCACCAATGCTTATATCAAACTAGTTAACTCTGGGGCCAAATGGAAAACATTATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACGACGACGACTACTGCGTCTCTGTTTTCTCGGTGCCACTCTTCTTCTTCTTTAAACTTCAAATGCGAACTCGAATCTCCCGCGAAAACGCGACTGTTCTCTCCGGCGACAGGGAGA
CATGTTGTCCGATCGTTAAAAGCATGTCGTATCCGTTGCTCCTCCAGTGATCCTA
GTTCACGTCATGTATTCGTGTCCAGTAGAAGACAAATGGCTGTCTTGTTATCCACTGTACAGCTT
CTGTCTCATTGGCTTCCCCCTGATGGAAAGGCAGCTGA
CATGTATCCACTGATGAAAGACGAGATAAGGAGAGTGGTGACGAAGGGTAAAGCTGCTGGTGTGCTTCGTTTAGTGTTTCAT
GATGCTGGAACCTTTGAACTTGATGATAACACAG
GTGGCATCAATGGGTCTATTGTTTATGAACTGGAAAGACCTGAAAACGCAGGTTTGAAGAGATCTCTAAAGGTTCTAGAGAAAGCA
AAGATTAAGGTTGATGAGATACAACCAG
TGTCTTGGGCCGATATGATCGCTGTTGGTGGCTCTGAAGCAGTCTCAATGTGCGGCGGCCCAACAATTCCAGTAGTTTTAGGAAGACTTGAT
TCAAT
GCAACCTGATCCAGAAGACAAGTTACCTCCAGAATCCCTCAATGCCTCGGGTTTAAAAGAATGTTTCCAAAGAAAAGGATTCTCGACCCAAGAACTTGTTGCCTTATCTGGTGCA
CATACGATTGGGAGTAAAGGCTTTGGAGATCCATTTACTTTTGACAATGCATACTACAAAATCCTTCTTGAAAAACCTTGGAGATCTACTACAT
CCAAAATGACGAGTATGGTTGGGCTT
CCTTCGGATCATGCCCTCGTGGAGGATGATGAGTGCTTAAG
GTGGGTGAAAGAGTATGCGGAAGACCAAGACAAGTTCTTCAGAGACTTCACCAATGCTTATATCAAACTAGTTAACTCT
GGGGCCAAATGGAAAACATTATGA

Retrieve as FASTA