Entry information : CvarAPx-R
Entry ID 8356
Creation 2011-05-02 (Christophe Dunand)
Last sequence changes 2011-07-27 (Catherine Mathe)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-05-27 (Christophe Dunand)
Peroxidase information: CvarAPx-R
Name CvarAPx-R
Class Ascorbate peroxidase related    [Orthogroup: APx-R001]
Taxonomy Eukaryota Viridiplantae Chlorophyta Trebouxiophyceae Chlorellaceae Chlorella
Organism Chlorella variabilis (C.sp. NC64A)    [TaxId: 554065 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CvarAPx-R
start..stop
S start..stop
CsorAPx-R 371 2e-129 111..350 81..319
CreAPx-R 298 3e-100 127..350 111..337
VcaAPx-R 258 1e-84 115..350 89..324
EUgAPx-R01 253 4e-84 119..346 4..235
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 79315..79710 396 N° 2 79051..79181 131 N° 3 78787..78913 127 N° 4 78445..78591 147
N° 5 78156..78264 109 N° 6 77829..77971 143  
complement(join(77829..77971,78156..78264,78445..78591,78787..78913,79051..79181 ,79315..79710))


exon

Literature and cross-references CvarAPx-R
Literature Blanc,G., Duncan,G., Agarkova,I., Borodovsky,M., Gurnon,J., Kuo,A. Lindquist,E., Lucas,S., Pangilinan,J., Polle,J., Salamov,A., Terry,A., Yamada,T., Dunigan,D.D., Grigoriev,I.V., Claverie,J.M. and Van Etten,J.L. The Chlorella variabilis NC64A Genome Reveals Adaptation to Photosymbiosis, Coevolution with Viruses, and Cryptic Sex Plant Cell 22 (9), 2943-2955 (2010).
DNA ref. GenBank:   GL433872.1 (79710..77829) JGI genome:   scaffold_38 (68402..70897)
Cluster/Prediction ref. JGI gene:   56419
Protein sequence: CvarAPx-R
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   350
PWM (Da):   %s   36576.43  
PI (pH):   %s   7.86
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MISSAPCQKGAVAQLHCSTVCHTPKRHAAVRCSCTASGETRLDGASRESRKLLTVPPADAVLTGGSSTRSSGAHPRRRDLLQAAMAAPLPQLLPWPGLAAAATAGEPGPRYLTAEQQAAVDAAFAATLPKSKAPVMVRLVFHDAGSYSAAAGDGGVNASIRFELDRPDNFGLKRGWNVIEATDKKLKGTAAEGAVSKADLIALAGAYAVRITGGPAIVAVGRQDAAAADPDGRMPELDFSAEQQLANFAAKGLSAQEFVVLSGSHTLGSKGYGDPVTFDNTYYKTLLQQPWVDKSNEMAQHTGIPTDHVLPDDPTCRPLIQRYAADQAAFFADFAAAYDKMASLGARWA

Retrieve as FASTA  
Remarks Complete sequence from genomic (5 introns). N-term uncertain...
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATCTCCAGTGCGCCCTGCCAGAAGGGGGCGGTAGCCCAGCTGCATTGCAGCACAGTCTGCCACACCCCCAAGCGACACGCGGCTGTGCGATGCAGCTGTACGGCCTCAGGTGAGACG
CGATTGGATGGCGCCAGCCGAGAGAGCCGCAAGCTGCTGACAGTGCCGCCTGCCGATGCTGTGCTCACAGGAGGAAGCAGCACGCGCTCCAGTGGCGCCCACCCTCGCAGACGAGACCTG
CTGCAAGCGGCAATGGCTGCGCCGCTGCCGCAGCTGCTCCCCTGGCCGGGGTTAGCGGCGGCGGCCACGGCCGGCGAGCCTGGTCCACGGTATCTCACCGCCGAGCAGCAGGCGGCCGTG
GATGCAGCATTCGCCGCCACGCTGCCCAAATCCAAG
GTGTGAAGGCTTTCCTTGTTGCATGGCCTTTGAGTCCCCTTCTGGCTGAAGGAATGAGAATGGCCACAACCCGCAGAGCACCGC
CTCACTCTGGTGGTGGTTCTGCTTCCATGCCCTTGCCTACCGCCTACAGGCCCCCGTCATGGTGCGCCTGGTGTTCCACGACGCCGGCTCCTACAGCGCCGCTGCCGGCGATGGCGGCGT
CAACGCCTCGATCCGGTTCGAGCTCGACCGCCCCGACAACTTTGGCCTGAAGCGCGGCTG
GTGCGCCATGTTCTGTTCATGCAAGTCGCCCACACCAACGGCCCATGCCACAAGCTGCTG
GCTGAGCCACCGCCTGCGCGTCATGCTCGCCCGCCAATCGATCGCTGTGGTGGTTTCACATGGCTCCGCGAGTGCAGGAACGTGATCGAGGCGACCGACAAGAAGCTCAAGGGCACGGCG
GCAGAGGGGGCAGTGTCCAAGGCAGACCTCATCGCGCTGGCAGGGGCGTACGCCGTGCGCATCACCGGCGGCCCTGCAATACAG
GTGTGGCGGTGGCGGGCTTGTGGGTCAGCAAGGCCA
CCGCGGTGCTTCACGCATGTGGGCTGTCTGCACACGCCCGTCAACCCGAGGCCAGGCACGGGGCACCAAGCATGCGGGAAGCAGGCATGGACAGGCAGCGGCATGTCATGCCTGCTCGCG
GCACCCCTCGCTCCCTACGTGCTCCTGCTGCGGCCGCAGGTGGCTGTGGGGCGGCAGGATGCTGCGGCCGCAGACCCCGACGGGCGCATGCCTGAGCTGGACTTCAGCGCCGAGCAGCAG
CTGGCCAACTTTGCGGCCAAGGGGCTCAGCGCCCAGGAATTTGTGGTGCTGTCGGGGTCGCACACG
GTGAGCAGAGGGGGGTGGCTGGGCTGGAGCGCGCCACAGACTGTTTGGATGAGC
TTGGATGGGCTGGCTCACATGCCGTCAGTCTGGTCTCCCTTTCTGCTCCGGTTTCCGTACCACTCGCTCCATGTGTGGTGCTAGTCCCCCTGCCTGCCTGACTCCCTGTCCTCTGCTTGT
GTGCAGCTGGGCAGCAAGGGGTATGGCGACCCGGTGACCTTTGACAACACCTACTACAAGACGCTGCTGCAACAGCCGTGGGTGGACAAGAGCAACGAGATGGCGCAGCACACGGGTGCG
CTGCCGGCCGCGTCGCAGCTGCCGGCCGGCGATGGCCACTGCGCTTTTGGGAAGCAGTGCAGCTGGCTTGCATTCTCTCGTCGCTCGGCTTCTCGGATTGCCAACCCGCACCACCACACC
GCACGGCCCTGCACACACATTGTGTCCACTGAGTGAGCCTGACCCGCCCACTGCCGCAGGGATCCCAACCGACCACGTCCTGCCCGACGACCCCACCTGTCGCCCCCTCATCCAGCGCTA
CGCCGCCGACCAGGCCGCCTTCTTTGCCGACTTTGCGGCGGCATACGACAAGATGGCCAGCCTGGGGGCGCGCTGGGCCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATCTCCAGTGCGCCCTGCCAGAAGGGGGCGGTAGCCCAGCTGCATTGCAGCACAGTCTGCCACACCCCCAAGCGACACGCGGCTGTGCGATGCAGCTGTACGGCCTCAGGTGAGACG
CGATTGGATGGCGCCAGCCGAGAGAGCCGCAAGCTGCTGACAGTGCCGCCTGCCGATGCTGTGCTCACAGGAGGAAGCAGCACGCGCTCCAGTGGCGCCCACCCTCGCAGACGAGACCTG
CTGCAAGCGGCAATGGCTGCGCCGCTGCCGCAGCTGCTCCCCTGGCCGGGGTTAGCGGCGGCGGCCACGGCCGGCGAGCCTGGTCCACGGTATCTCACCGCCGAGCAGCAGGCGGCCGTG
GATGCAGCATTCGCCGCCACGCTGCCCAAATCCAAG
GCCCCCGTCATGGTGCGCCTGGTGTTCCACGACGCCGGCTCCTACAGCGCCGCTGCCGGCGATGGCGGCGTCAACGCCTCGATC
CGGTTCGAGCTCGACCGCCCCGACAACTTTGGCCTGAAGCGCGGCTG
GAACGTGATCGAGGCGACCGACAAGAAGCTCAAGGGCACGGCGGCAGAGGGGGCAGTGTCCAAGGCAGACCTC
ATCGCGCTGGCAGGGGCGTACGCCGTGCGCATCACCGGCGGCCCTGCAATACAG
GTGGCTGTGGGGCGGCAGGATGCTGCGGCCGCAGACCCCGACGGGCGCATGCCTGAGCTGGACTTC
AGCGCCGAGCAGCAGCTGGCCAACTTTGCGGCCAAGGGGCTCAGCGCCCAGGAATTTGTGGTGCTGTCGGGGTCGCACACG
CTGGGCAGCAAGGGGTATGGCGACCCGGTGACCTTTGAC
AACACCTACTACAAGACGCTGCTGCAACAGCCGTGGGTGGACAAGAGCAACGAGATGGCGCAGCACACGG
GGATCCCAACCGACCACGTCCTGCCCGACGACCCCACCTGTCGCCCCCTC
ATCCAGCGCTACGCCGCCGACCAGGCCGCCTTCTTTGCCGACTTTGCGGCGGCATACGACAAGATGGCCAGCCTGGGGGCGCGCTGGGCCTGA

Retrieve as FASTA