Entry information : OtAPx-R
Entry ID 8358
Creation 2011-05-03 (Christophe Dunand)
Last sequence changes 2011-06-14 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2011-07-28 (Catherine Mathe)
Peroxidase information: OtAPx-R
Name OtAPx-R
Class Ascorbate peroxidase related    [Orthogroup: APx-R001]
Taxonomy Eukaryota Viridiplantae Chlorophyta Prasinophyceae Ostreococcus
Organism Ostreococcus tauri    [TaxId: 70448 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OtAPx-R
start..stop
S start..stop
OlAPx-R 426 1e-151 66..311 73..318
BprAPx-R01 324 1e-110 66..307 120..365
MpuAPx-R 294 4e-99 66..310 105..346
EUgAPx-R01 272 5e-92 70..311 1..239
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 33617..33807 191 N° 2 33957..34707 751  
join(33617..33807,33957..34707)


exon

Literature and cross-references OtAPx-R
Protein ref. UniProtKB:   Q014C0 [Incorrect prediction]
DNA ref. GenBank:   CR954208.4 (33617..34707)
mRNA ref. GenBank:   XM_003080543.1 [Incorrect prediction]
Protein sequence: OtAPx-R
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   313
PWM (Da):   %s   33804.82  
PI (pH):   %s   6.8
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPATARASASAPTSRSPRPSSSSTTRSKVDRAPVLTRRDVASVALACAFARTIVRPDVALALERADEGAIRRAIRASLEREVPTSKCPAVLRLVFHDAGTHSASEKDGGMNGSVRYELSRPESFGLKRGLTPVKNAYDGLQGTAAEGKVSFSDMIACAGAYAVEITGGPSFLERVPIGRVDATSADPENRMPEQTLSGKDMREHFARSGIDTRDMVALAGAHTIGGKGFGDMYTFDNAYYVTLVADPWHKPNMTKDEASMAEHIGLPSDKYMREDAESMLWIKKYAEDQEAFFEDFVDAYIRLTKLGATFSTE

Retrieve as FASTA  
Remarks Complete sequence from gnomic. No EST available.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCCGCCACCGCGCGCGCGTCCGCGTCCGCACCGACCTCGAGGTCTCCCCGACCGTCGTCCTCGTCGACGACGCGCTCGAAGGTCGATCGCGCGCCCGTGCTCACCAGACGTGACGTC
GCCTCGGTCGCCCTCGCGTGCGCGTTCGCGCGAACGATCGTTCGTCCCGACGTCGCGCTCGCGCTCGAGAG
GTGCGATCGATCGAGACGCGATCGCGAACGGGATGCGATCGGGCGTCAC
ACACTGGCGCGCGTCGACCGCGTCGTGCGAGCGTTCGAGAGCGTACACGACGTCCGAGAGCGTCGAGAGAACTGACCGCGCGCGACGTCCGAACGCGCAGGGCGGACGAGGGAGCGATTC
GACGAGCGATTCGAGCGTCGCTGGAGAGGGAAGTGCCGACGTCGAAGTGCCCAGCGGTGTTACGGTTGGTTTTCCACGACGCCGGGACGCACTCGGCGAGCGAGAAGGATGGAGGGATGA
ACGGGAGCGTGCGATACGAGCTCAGCCGACCAGAGTCTTTCGGCCTGAAGCGAGGGCTCACTCCGGTGAAGAACGCGTACGACGGTCTGCAAGGTACCGCAGCGGAGGGTAAGGTATCTT
TCTCGGACATGATCGCGTGCGCTGGGGCGTACGCGGTGGAGATCACCGGTGGACCTTCGTTTTTGGAGCGCGTCCCGATCGGTCGCGTCGACGCGACGTCGGCCGATCCAGAGAATAGAA
TGCCAGAGCAGACTCTGAGCGGAAAGGACATGCGCGAGCACTTCGCGAGGAGTGGTATAGATACACGCGATATGGTCGCGCTCGCGGGCGCTCACACGATAGGGGGAAAGGGATTCGGTG
ACATGTACACGTTCGATAACGCCTACTACGTCACGCTCGTCGCCGATCCGTGGCATAAACCAAACATGACCAAGGACGAGGCATCTATGGCCGAACACATCGGTTTACCCAGTGACAAGT
ACATGCGAGAAGATGCGGAGAGCATGCTTTGGATTAAGAAGTACGCAGAGGATCAGGAAGCCTTCTTTGAAGACTTTGTCGACGCGTACATTCGGCTCACAAAGCTCGGAGCGACTTTCA
GTACCGAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCCGCCACCGCGCGCGCGTCCGCGTCCGCACCGACCTCGAGGTCTCCCCGACCGTCGTCCTCGTCGACGACGCGCTCGAAGGTCGATCGCGCGCCCGTGCTCACCAGACGTGACGTC
GCCTCGGTCGCCCTCGCGTGCGCGTTCGCGCGAACGATCGTTCGTCCCGACGTCGCGCTCGCGCTCGAGAG
GGCGGACGAGGGAGCGATTCGACGAGCGATTCGAGCGTCGCTGGAGAGG
GAAGTGCCGACGTCGAAGTGCCCAGCGGTGTTACGGTTGGTTTTCCACGACGCCGGGACGCACTCGGCGAGCGAGAAGGATGGAGGGATGAACGGGAGCGTGCGATACGAGCTCAGCCGA
CCAGAGTCTTTCGGCCTGAAGCGAGGGCTCACTCCGGTGAAGAACGCGTACGACGGTCTGCAAGGTACCGCAGCGGAGGGTAAGGTATCTTTCTCGGACATGATCGCGTGCGCTGGGGCG
TACGCGGTGGAGATCACCGGTGGACCTTCGTTTTTGGAGCGCGTCCCGATCGGTCGCGTCGACGCGACGTCGGCCGATCCAGAGAATAGAATGCCAGAGCAGACTCTGAGCGGAAAGGAC
ATGCGCGAGCACTTCGCGAGGAGTGGTATAGATACACGCGATATGGTCGCGCTCGCGGGCGCTCACACGATAGGGGGAAAGGGATTCGGTGACATGTACACGTTCGATAACGCCTACTAC
GTCACGCTCGTCGCCGATCCGTGGCATAAACCAAACATGACCAAGGACGAGGCATCTATGGCCGAACACATCGGTTTACCCAGTGACAAGTACATGCGAGAAGATGCGGAGAGCATGCTT
TGGATTAAGAAGTACGCAGAGGATCAGGAAGCCTTCTTTGAAGACTTTGTCGACGCGTACATTCGGCTCACAAAGCTCGGAGCGACTTTCAGTACCGAGTAA

Retrieve as FASTA