Entry information : CgraCP02 (CgraKatG2)
Entry ID 8362
Creation 2011-05-05 (Marcel Zamocky)
Last sequence changes 2011-06-09 (Catherine Mathe)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-05-10 (Christophe Dunand)
Peroxidase information: CgraCP02 (CgraKatG2)
Name (synonym) CgraCP02 (CgraKatG2)
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Glomerellaceae Glomerella
Organism Colletotrichum graminicola (Glomerella graminicola)    [TaxId: 31870 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CgraCP02
start..stop
S start..stop
CfioCP02_MH18 1342 0 1..776 1..776
CfioCP02_PJ7 1340 0 1..776 1..776
CgloCP01_ST23 1328 0 1..775 1..775
MgrCP02 1238 0 1..775 1..783
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 294741..295038 298 N° 2 294519..294673 155 N° 3 294037..294109 73 N° 4 293419..293850 432
N° 5 293136..293271 136 N° 6 291672..292908 1237  
complement(join(291672..292908,293136..293271,293419..293850,294037..294109,2945 19..294673,294741..295038))


exon

Literature and cross-references CgraCP02 (CgraKatG2)
Literature Vaillancourt L., et al., The genome sequence of Glomerella graminicola strain M1.001. (unpublished since 2009)

Protein ref. GenBank:   EFQ34482.1 UniProtKB:   E3QUE4
DNA ref. GenBank:   GG697380.1 (295038..291672)
Protein sequence: CgraCP02 (CgraKatG2)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   776 (755)
PWM (Da):   %s   84284.99 (82206.9)  
PI (pH):   %s   5.19 (5.05) Peptide Signal:   %s   cut: 22 range:22-776
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHAKLSNCLLAASAILPSVSAQGCPFAKRDGSVSSELPKRDTAATFGRCPTISNEAGGGTRSRDWWPCQLRLDVLRQFQPSTNPYGGDFDYVKAFSSLDYDALKADLRALLTESQDWWPADFGHYGGLFIRLCWHSAGTYRAIDGRGGGGGQQRFAPLNSWPDNQNLDKARRLLWPIKQKYGNKISWADLILLAGNTALDDMGFKTLGFAAGRPDTWQADESIYWGGETTFVPKGNDVRYNGSTDIFERADKLEKPLASTNMGLIYVNPEGPDGSSNPAASANDIRTAFHRMGMNDSETVALIAGGHAFGKTHGAVSADNIGPEPEAASIGEMGLGWHNSVGDGNGVNQMTSGLEVIWTKTPTKWSNDYLESLLHNKWTLVTSPAGHHQWEAVNGTLDYPDPFDATKFRKATMLTSDLALINDPSYLNITTRWVDHPDELADAFAKAWFKLLHRDMGPRARYLGPEVPQETFIWQDPLPAREGDLMDDADVATLKSTILAVPGLDVSKLASVAWASASTFRGSDKRGGANGARIALEPQVNWVANNPTQLSAVLDALKKVQADFNTGSKKVSLADLIVLGGTAAVEKAAADAGVKVTVPFAPGRVDATQDQTDIESFGYLEPQADGFRNYGRGTARARTEEFLVDKAAQLTLSPPEMTVLVGGLRALGAVFDGSNTGVLTEKKGQLTNDYFKNLLDISTVWSQSDTDGETWKGVDRKTKTEKWTATRADLVFGSHAELRAISEVYASSDANEKFVNDFVAAWTKVMNLDRFDLQK

Retrieve as FASTA  
Remarks Complete sequence from genomic (5 introns). Strain="M1.001"
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCACGCCAAACTGTCAAACTGCCTTCTGGCGGCCTCTGCTATCCTGCCCAGCGTCTCTGCCCAGGGTTGTCCCTTTGCCAAACGAGACGGCTCAGTGAGCAGCGAGCTTCCCAAGAGG
GACACAGCCGCGACCTTTGGTCGATGTCCCACCATCAGCAACGAGGCTGGCGGCGGCACTCGCAGCCGCGACTGGTGGCCATGCCAGCTTAGACTCGACGTTCTCCGTCAATTCCAGCCC
TCGACCAACCCGTACGGAGGCGACTTCGACTATGTCAAGGCCTTCAGCTCTCTCGACT
GTGAGTCCTGACCTGCGGGTGGATAGCACCCGTTGTCAACTGCCGCGGCTTTACTAACACGG
GACAGACGATGCCCTCAAGGCGGACTTGCGCGCTCTCCTCACCGAATCTCAGGATTGGTGGCCCGCCGACTTTGGCCACTATGGAGGCCTGTTCATCCGTCTTTGCTGGCATAGCGCCGG
CACGTACCGCGCCATTGACGGCCGCGGTGGCGGTGGCATG
GTGAGCCTCCTTCCCACCACACCCCCTCGTTTCTTGTTTCTTGTTTCGTCGTCTAGCCTCTTCTGTCCGGCCCCCGGTTA
TCCCCGGTAACCCCCCTTTGCTTCTTCCTTGCTCGCTCGCAGCATCTCTCGGCGCATTTCTTTTGCCTCACGACAGAGGTACACTTGGCACTTTTGACCCTCCATCACTGATCTCATTCG
TCTCACAAACGAACATCAAATGAGGGGCGGGGTTTACCGGAGGGTTTCTGGCCTATCCCGTCCTCGTGCCAAGTGGTGCACACGCATTTCTTTTCTCCACACTTGCTGCCCATCGAATTA
TGGGCGGGCAGGTGTCTTCACCTTATCACTTTGCAGCATCACTTCTATCATTTTGAGGACTGGCATTAACTAATATTGGTATATTGCAGGGTCAACAACGGTTCGCTCCACTCAACAGCT
GGCCGGACAATCAGAACCTTGACAAGGCTCGTCGCCTCCTAT
GTAAGCTAGCCCCCACTCCTCCCTCCCTCCATCAAGGACCCCATGTCAACTGCCTCTTCGGTTCGCTCGCCACGCATC
CACTCCCCCAGTGGCTAGGTAATGGCGACAGTCCAAGATGCTAAGGGGGCCTTGTGGGAGGGGAGTAAGAAAACTACCTGCAGTATGCTGATCCATGCTATCCCGTAGGGCCAATCAAGC
AGAAGTATGGCAACAAGATCTCGTGGGCGGACCTAATCCTCCTGGCTGGAAACACTGCCCTCGATGATATGGGCTTCAAGACTCTTGGCTTCGCCGCAGGCCGCCCCGACACGTGGCAGG
CCGACGAATCCATCTACTGGGGCGGCGAGACGACCTTCGTGCCCAAGGGAAACGACGTCCGCTATAATGGCAGCACCGACATCTTCGAGCGCGCTGACAAGCTGGAGAAGCCTCTGGCCT
CTACAAACATGGGCCTCATCTATGTCAACCCGGAAGGCCCTGACGGTAGTTCCAACCCCGCCGCCTCGGCGAACGACATCCGCACTGCATTCCATCGCATGGGAATGAACGATTCAGAGA
CTGTCGCTCTCATCGCCGGTGGACACGCCTTTGGCAAGACCCACGGTGCCGTTTCTGCTG
GTGAGTCTAGCAAGCATTATTCGGATGGGGGCTGTATCTAGTTCTTGGCAGCGTGGAAAT
GCTCCGACCCTTCAAATCCCCTCCCCACCCCTTGTCTCGCGTCGCCAGTCGAGAGAGAACACGCAGACTAACGCACGCATTTTGCAGACAACATCGGACCTGAGCCTGAGGCTGCTAGTA
TCGGCGAGATGGGCCTAGGATGGCACAACAGCGTTGGCGACGGCAATGGCGTCAACCAGATGACCAGTGGTCTGGAAGTGATCTGGACCAAGACCCCTACCAA
GTAAGTGATTGTGATGA
ACTCCTTCAGGCTTCGTCTTACCACGCACTCCCCCACTCCCTGCATCTCCTTAAACCCCTTTCGCCTCCGATGCTTTTTATCCGCCACGTGCTGTAGGTATTCGCCTCATGGGACAGGAC
CAATGAGGCAAAACCGATGAAGACCTCAGCTATTTATATCAGCTGTGTGATTATGCAGTGAAACAGTAAGGCTAATCCTTGTCCCTGTAGATGGAGCAACGACTACTTGGAGTCGCTTCT
GCACAACAAATGGACCCTAGTCACCAGCCCTGCAGGTCATCACCAATGGGAGGCTGTCAACGGCACCCTCGACTACCCCGACCCCTTTGATGCCACCAAGTTCCGCAAGGCGACTATGCT
CACTAGCGACTTGGCCCTCATCAACGATCCTTCCTATCTCAACATCACCACTCGATGGGTGGACCACCCCGATGAGCTCGCTGATGCGTTCGCCAAGGCTTGGTTCAAGCTCCTCCACCG
TGACATGGGCCCTCGGGCTCGCTACCTCGGCCCCGAAGTCCCCCAGGAGACCTTCATCTGGCAGGACCCTCTTCCCGCCAGGGAGGGTGACCTGATGGATGATGCCGATGTCGCCACTCT
GAAGTCCACCATCCTTGCGGTCCCCGGCTTGGACGTCTCCAAGCTCGCCTCCGTCGCCTGGGCCTCTGCCTCGACCTTCCGTGGCTCCGACAAGCGCGGTGGAGCCAACGGCGCCCGCAT
TGCCCTTGAGCCCCAGGTCAACTGGGTTGCCAACAACCCCACGCAGCTCTCCGCGGTCCTCGACGCCCTGAAGAAAGTTCAGGCCGACTTTAACACCGGCTCCAAGAAGGTTTCCCTCGC
CGACCTGATCGTTCTCGGTGGTACAGCCGCCGTCGAGAAGGCTGCCGCGGACGCTGGCGTCAAAGTCACCGTTCCGTTTGCCCCCGGCCGCGTCGATGCTACCCAGGATCAAACCGACAT
CGAATCCTTCGGCTACCTTGAGCCCCAGGCCGATGGCTTCCGCAACTACGGCCGCGGCACCGCTCGCGCCCGCACCGAGGAGTTCCTCGTCGACAAGGCCGCCCAGCTGACCCTCAGCCC
CCCTGAGATGACTGTCCTTGTCGGCGGCCTCCGCGCCCTCGGCGCCGTCTTCGATGGCTCCAACACCGGCGTGCTCACCGAAAAGAAGGGCCAGCTGACCAACGACTACTTCAAGAACCT
CCTCGACATCTCCACCGTCTGGTCCCAGAGCGACACCGACGGGGAGACGTGGAAGGGAGTCGACCGCAAGACCAAGACCGAAAAGTGGACCGCCACCCGCGCCGACCTCGTCTTCGGTTC
CCACGCCGAGCTCCGTGCCATCTCCGAGGTCTACGCCAGCTCTGACGCCAACGAGAAGTTTGTCAACGACTTCGTCGCGGCCTGGACCAAGGTCATGAACCTTGACCGCTTCGACCTGCA
GAAATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCACGCCAAACTGTCAAACTGCCTTCTGGCGGCCTCTGCTATCCTGCCCAGCGTCTCTGCCCAGGGTTGTCCCTTTGCCAAACGAGACGGCTCAGTGAGCAGCGAGCTTCCCAAGAGG
GACACAGCCGCGACCTTTGGTCGATGTCCCACCATCAGCAACGAGGCTGGCGGCGGCACTCGCAGCCGCGACTGGTGGCCATGCCAGCTTAGACTCGACGTTCTCCGTCAATTCCAGCCC
TCGACCAACCCGTACGGAGGCGACTTCGACTATGTCAAGGCCTTCAGCTCTCTCGACT
ACGATGCCCTCAAGGCGGACTTGCGCGCTCTCCTCACCGAATCTCAGGATTGGTGGCCCGCC
GACTTTGGCCACTATGGAGGCCTGTTCATCCGTCTTTGCTGGCATAGCGCCGGCACGTACCGCGCCATTGACGGCCGCGGTGGCGGTGGCATG
GGTCAACAACGGTTCGCTCCACTCAAC
AGCTGGCCGGACAATCAGAACCTTGACAAGGCTCGTCGCCTCCTAT
GGCCAATCAAGCAGAAGTATGGCAACAAGATCTCGTGGGCGGACCTAATCCTCCTGGCTGGAAACACTGCCCTC
GATGATATGGGCTTCAAGACTCTTGGCTTCGCCGCAGGCCGCCCCGACACGTGGCAGGCCGACGAATCCATCTACTGGGGCGGCGAGACGACCTTCGTGCCCAAGGGAAACGACGTCCGC
TATAATGGCAGCACCGACATCTTCGAGCGCGCTGACAAGCTGGAGAAGCCTCTGGCCTCTACAAACATGGGCCTCATCTATGTCAACCCGGAAGGCCCTGACGGTAGTTCCAACCCCGCC
GCCTCGGCGAACGACATCCGCACTGCATTCCATCGCATGGGAATGAACGATTCAGAGACTGTCGCTCTCATCGCCGGTGGACACGCCTTTGGCAAGACCCACGGTGCCGTTTCTGCTG
AC
AACATCGGACCTGAGCCTGAGGCTGCTAGTATCGGCGAGATGGGCCTAGGATGGCACAACAGCGTTGGCGACGGCAATGGCGTCAACCAGATGACCAGTGGTCTGGAAGTGATCTGGACC
AAGACCCCTACCAA
ATGGAGCAACGACTACTTGGAGTCGCTTCTGCACAACAAATGGACCCTAGTCACCAGCCCTGCAGGTCATCACCAATGGGAGGCTGTCAACGGCACCCTCGACTAC
CCCGACCCCTTTGATGCCACCAAGTTCCGCAAGGCGACTATGCTCACTAGCGACTTGGCCCTCATCAACGATCCTTCCTATCTCAACATCACCACTCGATGGGTGGACCACCCCGATGAG
CTCGCTGATGCGTTCGCCAAGGCTTGGTTCAAGCTCCTCCACCGTGACATGGGCCCTCGGGCTCGCTACCTCGGCCCCGAAGTCCCCCAGGAGACCTTCATCTGGCAGGACCCTCTTCCC
GCCAGGGAGGGTGACCTGATGGATGATGCCGATGTCGCCACTCTGAAGTCCACCATCCTTGCGGTCCCCGGCTTGGACGTCTCCAAGCTCGCCTCCGTCGCCTGGGCCTCTGCCTCGACC
TTCCGTGGCTCCGACAAGCGCGGTGGAGCCAACGGCGCCCGCATTGCCCTTGAGCCCCAGGTCAACTGGGTTGCCAACAACCCCACGCAGCTCTCCGCGGTCCTCGACGCCCTGAAGAAA
GTTCAGGCCGACTTTAACACCGGCTCCAAGAAGGTTTCCCTCGCCGACCTGATCGTTCTCGGTGGTACAGCCGCCGTCGAGAAGGCTGCCGCGGACGCTGGCGTCAAAGTCACCGTTCCG
TTTGCCCCCGGCCGCGTCGATGCTACCCAGGATCAAACCGACATCGAATCCTTCGGCTACCTTGAGCCCCAGGCCGATGGCTTCCGCAACTACGGCCGCGGCACCGCTCGCGCCCGCACC
GAGGAGTTCCTCGTCGACAAGGCCGCCCAGCTGACCCTCAGCCCCCCTGAGATGACTGTCCTTGTCGGCGGCCTCCGCGCCCTCGGCGCCGTCTTCGATGGCTCCAACACCGGCGTGCTC
ACCGAAAAGAAGGGCCAGCTGACCAACGACTACTTCAAGAACCTCCTCGACATCTCCACCGTCTGGTCCCAGAGCGACACCGACGGGGAGACGTGGAAGGGAGTCGACCGCAAGACCAAG
ACCGAAAAGTGGACCGCCACCCGCGCCGACCTCGTCTTCGGTTCCCACGCCGAGCTCCGTGCCATCTCCGAGGTCTACGCCAGCTCTGACGCCAACGAGAAGTTTGTCAACGACTTCGTC
GCGGCCTGGACCAAGGTCATGAACCTTGACCGCTTCGACCTGCAGAAATAA

Retrieve as FASTA