Entry information : GclCP02 (GclKatG2)
Entry ID 8363
Creation 2011-05-05 (Marcel Zamocky)
Last sequence changes 2011-05-06 (Marcel Zamocky)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2011-05-19 (Catherine Mathe)
Peroxidase information: GclCP02 (GclKatG2)
Name (synonym) GclCP02 (GclKatG2)
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Ophiostomataceae Grosmannia
Organism Grosmannia clavigera    [TaxId: 226899 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GclCP02
start..stop
S start..stop
GdesCP01 1086 0 1..793 1..794
TaspCP01 1052 0 7..795 2..791
TatCP02 1048 0 7..795 2..790
HjCP02 1047 0 7..796 2..789
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 30702..31026 325 N° 2 31091..31318 228 N° 3 31373..31957 585 N° 4 32021..32263 243
N° 5 32326..32660 335 N° 6 32735..32930 196 N° 7 32989..33482 494  
join(30702..31026,31091..31318,31373..31957,32021..32263,32326..32660,32735..329 30,32989..33482)


exon

Literature and cross-references GclCP02 (GclKatG2)
Literature Diguistini S., Wang Y., Liao N.Y., Taylor G., Tanguay P., Feau N., Henrissat B., Chan S.K., Hesse-Orce U., Alamouti S.M., Tsui C.K., Docking R.T., Levasseur A., Haridas S., Robertson G., Birol I., Holt R.A., Marra M.A. , Hamelin R.C., Hirst M., Jones S.J., Bohlmann J., Breuil C. (2011) Genome and transcriptome analyses of the mountain pine beetle-fungal symbiont Grosmannia clavigera, a lodgepole pine pathogen. Proc. Natl. Acad. Sci. U.S.A. 108:2504-2509

Protein ref. GenBank:   EFX01688.1 UniProtKB:   F0XL63
DNA ref. GenBank:   GL629788.1 (30702..33482)
Protein sequence: GclCP02 (GclKatG2)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   801 (778)
PWM (Da):   %s   87290.15 (84888.9)  
PI (pH):   %s   5.04 (5.03) Peptide Signal:   %s   cut: 24 range:24-801
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFDTVSPSRLLALTVCSLPLVSAAACPFGHSKRDAVPDFHKPMLQERYSADGADFGVCPRKANVAGGGTRSKDWWPCALSLAVLRQNADQSNPLGGDFDYATEFAKLDVEALRKDITELQTNSQEWWPADFGNYGGFFIRMAWHSAGTYRQIDGRGGSGMGQQRFAQLNSWADNASLDKARRLLWPIKQKYGNMISWADLMEFTGHVAIENMGLPLYGFGFGRVDTWQADEGIYWGSEHEMYSQPGSYKDRYNGSTDITDRADKLEKPLSATNMGLIYVDPQGPSGNPEPAGSALDIRETFGRMGMDDEETVSLIAGGHTFGKTHGAVSGDYIGPEPMAAPIELQGLGWKNSFESGVGENAYTSGIEVIWSKTPTNWSNHFFDSLFGNNWTLASSPAGAHQWEAVNGNVSIPDPFVAGKFRKPTMLTSDLALLNDVSYLNISNTFWNDPKYFGETFARTWFKLLHRDMGPISRYLGPYVPKTQLIWQDPLPTVSSQTIDDADVTQLKAAILSSCNLSSGLNTSSLITTAWGAASSFRISDKRGGANGGRIALEPQNSFAVNNPDRLKIVLPLEKVMTDFNSKNTGKKVSLADLIVLGGTAAVEKAAKDAGLTVSVPFTPGRVDTTQELTDVKSFAFLEPVADGFRNYGQGNARALTEELLVDKASLLSLTVPEMTVLVGGMRSLDANYDGSSYGIFTDRPGKLSNDFFVNLLNISTTWTAVNGTNDEIFTGTDLYTGASKYTATRADLIFGSHPELRAVAEVYGSSTAQQKFADDFVKAWAKVMDLDRYDVKGRKQNNVQ

Retrieve as FASTA  
Remarks Complete sequence from genomic (Chromo unplaced, 6 introns). No EST available. Strain="kw1407"
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCGACACAGTTTCTCCCAGTCGCCTCTTGGCGCTCACCGTCTGCTCGCTTCCGCTTGTCTCGGCCGCGGCCTGTCCATTTGGCCATAGCAAGCGCGATGCTGTGCCTGACTTCCAC
AAACCTATGCTACAGGAGCGGTACAGCGCAGACGGGGCTGACTTTGGCGTGTGCCCGAGGAAGGCCAACGTCGCTGGCGGTGGCACGCGCAGCAAGGACTGGTGGCCCTGTGCCCTAAGC
CTGGCTGTGCTGCGTCAGAATGCCGACCAGTCCAACCCACTGGGCGGAGATTTCGACTACGCCACTGAGTTTGCCAAGCTTGATG
GTAGGTCGCCACGCCCAAGAATAAAGAAACCTGCA
GAGACACCCGGTGCTGACCTGATGTACAGTGGAGGCGCTCAGGAAGGACATCACGGAGCTGCAAACCAACTCCCAGGAATGGTGGCCTGCAGATTTCGGCAACTATGGCGGCTTCTTCAT
CCGGATGGCCTGGCACAGCGCCGGTACCTACCGCCAGATCGACGGTCGTGGCGGATCTGGCATGGGCCAGCAGCGTTTTGCCCAGCTGAACAGCTGGGCTGACAATGCCAGTCTCGACAA
GGCTCGCCGTCTTCTTT
GTACGTGCTGTCTGACGGCCTAGCAGTCTGGCTCGCAGCTAATCAGCATTCTAGGGCCGATCAAGCAGAAGTACGGCAACATGATCTCGTGGGCCGACCTGAT
GGAGTTCACCGGCCACGTCGCCATCGAGAACATGGGCCTCCCTCTGTACGGCTTTGGCTTTGGCCGGGTCGACACCTGGCAGGCCGATGAGGGCATCTACTGGGGCTCTGAGCACGAGAT
GTACTCGCAGCCCGGCAGCTACAAGGACCGCTACAACGGCAGCACCGACATCACCGACCGTGCCGACAAGCTCGAGAAGCCGCTCAGTGCCACCAACATGGGCTTGATCTACGTCGACCC
ACAGGGTCCCAGTGGCAATCCTGAGCCGGCCGGCTCTGCTCTCGACATTCGCGAGACGTTTGGTCGCATGGGCATGGACGACGAGGAGACCGTTTCCCTGATTGCAGGTGGCCACACTTT
CGGAAAGACCCACGGTGCTGTTTCTGGAGACTACATCGGTCCTGAGCCAATGGCTGCTCCCATCGAGCTGCAGGGTCTCGGGTGGAAGAACAGCTTTGAAAGCGGTGTGGGCGAGAATGC
CTACACTTCTGGCATTGAGGTCATCTGGAGCAAGACGCCTACCAACTGGTCCAACC
GTAAGATATTCTGGTCGTTGAAAGCCGGAAAAGAGACTGCGTGCTAATGGGTGGACGCTCCAGA
CTTCTTCGATTCCCTCTTTGGCAACAACTGGACGCTCGCCTCGAGTCCGGCTGGTGCACACCAGTGGGAGGCTGTCAACGGCAACGTTTCCATTCCAGACCCGTTCGTTGCTGGAAAGTT
CCGGAAGCCCACCATGTTGACGAGCGATCTGGCTCTTCTCAACGACGTGTCCTACCTCAACATCTCCAACACTTTCTGGAACGACCCGAAGTACTTTGGCGAGACGTTTGCGCGCACCTG
GT
GTATGTTCTCCAAGTACTGCCTTCTCGTTTCACTCGATACTAATCTTCTGTCTCCTGCACAGTCAAGCTTCTCCACCGTGACATGGGCCCGATTTCGCGCTATCTCGGACCCTACGTC
CCCAAGACGCAGCTGATCTGGCAAGATCCCCTCCCGACGGTTTCTTCCCAGACCATCGACGATGCCGATGTGACTCAGCTGAAGGCTGCCATCCTTTCTTCCTGCAACTTGAGCTCCGGC
CTGAACACCTCCAGCCTTATCACCACCGCCTGGGGTGCTGCTTCGAGCTTCCGGATCTCTGACAAGCGCGGTGGTGCTAACGGCGGCCGCATTGCCCTGGAGCCACAGAACTCGTTCGCG
GTTAACAACCCGGACCGCCTGAAGATCGTTCTGCCTGCT
GTAAGCAAATGTGATGCGCATAGCCCTACTTCTGTGCTCCTTCTCCATTCAAACTTTACTAATGCCCTGTCTAGCTGGAGA
AAGTGATGACCGACTTCAACTCCAAGAACACTGGGAAGAAGGTATCTCTGGCTGATCTCATCGTTCTTGGCGGCACCGCTGCAGTCGAGAAGGCGGCCAAGGATGCTGGCTTGACAGTGT
CGGTTCCTTTCACCCCTGGCCGCGTGGACACCACCCAAGAACTCACCGACGTGAAGTCGTTTGCTTTCC
GTATGTTCTCCTCAACCCAAACCGCCCCGAACACCATAACTGACTCCTCTC
CTTTCAGTCGAGCCTGTCGCCGACGGCTTCCGCAACTACGGCCAGGGCAATGCTCGCGCCCTGACGGAGGAGCTGCTGGTCGACAAGGCCAGTCTTCTCAGCCTCACCGTTCCGGAGATG
ACAGTCCTTGTCGGCGGCATGCGTTCCCTGGACGCAAACTACGACGGGTCCAGCTACGGCATCTTCACTGACCGTCCTGGCAAGCTGTCGAACGATTTCTTCGTGAACCTGCTCAACATC
TCGACCACCTGGACGGCTGTCAACGGCACCAACGACGAGATCTTCACGGGCACCGATCTGTACACCGGAGCCTCCAAGTATACGGCTACGCGTGCTGACCTGATCTTCGGTTCGCACCCC
GAGCTGCGGGCCGTTGCAGAGGTTTACGGTTCCAGCACCGCGCAACAGAAGTTTGCAGACGACTTTGTCAAGGCCTGGGCCAAGGTGATGGACCTGGACCGCTACGATGTCAAGGGGCGC
AAGCAGAACAATGTCCAGTAA

Retrieve as FASTA