Entry information : SbPrx40 ( Sobic.002G391800.1 [2.1] / SB02G040720 [1.4])
Entry ID 837
Creation 2005-12-19 (Christophe Dunand)
Last sequence changes 2005-12-19 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbPrx40 ( Sobic.002G391800.1 [2.1] / SB02G040720 [1.4])
Name (synonym) SbPrx40 ( Sobic.002G391800.1 [2.1] / SB02G040720 [1.4])
Class Class III peroxidase    [Orthogroup: Prx122]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue types Leaves
Roots
Seedlings
Inducers Acid treatment
Alkaline treatment
Ethylene treatment
Oxidative stress
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx40
start..stop
S start..stop
SbPrx39 332 1e-112 23..382 17..368
HvPrx64 322 6e-109 5..382 2..356
SiPrx142 308 9e-104 60..382 3..320
TaPrx47 308 4e-103 12..382 11..359
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 74620320..74620724 405 N° 2 74619450..74620208 759  
complement(join(74619450..74620208,74620320..74620724))


exon

Literature and cross-references SbPrx40 ( Sobic.002G391800.1 [2.1] / SB02G040720 [1.4])
Literature Cordonnier-Pratt,M.-M. et al., unpublished
DNA ref. Phytozome 12:   chromosome_2 (74620724..74619450)
Cluster/Prediction ref. PlantGDB:   SbGSStuc11-12-04.6450.1
Protein sequence: SbPrx40 ( Sobic.002G391800.1 [2.1] / SB02G040720 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   387 (359)
PWM (Da):   %s   41527.57 (38566.0) Transmb domain:   %s   i13-35o
PI (pH):   %s   5.74 (4.97) Peptide Signal:   %s   cut: 29 range:29-387
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MMAAAWKNKHAALIITVLAFLAPMACHGGGLINFTLLCSGGWVRPITVSLPPLVTITIGCPNNGPSEDPYVPPSPNPNNEPAPPSGAGLYLDYYNYSCPNAETIVREVVEDEIAKQGRGIGAGLIRLHFHDCFVQGCDASVLLNTTASGNSDTEREGGANKNSLRGLDVIDKAKAALEKACPSTAVSCADILAFAARDAARNLSGGKIEYKTPAGRWDGRESSADETGTLPGPFSPLDTLVAKFADQGLNRTDLVLLSAAHSIGRARCIFRSSRPGMNQTLVDDLNGQCKSNTSSVNQDYKTPDVLDSQYYQNVFDNDALFDSDAALTSSIYTKALVETYRTNLMNQFEKDFGEAMVKMGKIKTKTKGDKDVEIRKQCWTYNAPPNY*

Retrieve as FASTA  
Remarks Complete genomic (chromo 2, intron 1) and 6 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGGCAGCAGCTTGGAAGAATAAGCATGCTGCACTAATCATCACCGTGCTCGCGTTCCTCGCACCCATGGCGTGCCATGGCGGCGGCCTCATCAATTTCACTCTCCTCTGCTCGGGA
GGGTGGGTTCGCCCAATAACAGTCAGCCTCCCGCCGTTAGTGACCATCACGATCGGCTGTCCTAATAATGGCCCCAGCGAGGACCCCTATGTGCCTCCAAGTCCCAATCCCAACAACGAG
CCTGCTCCTCCCTCAGGAGCAGGGCTCTACTTGGACTACTACAATTACTCGTGCCCTAACGCCGAGACCATCGTCAGGGAGGTTGTGGAGGACGAGATCGCGAAACAGGGCCGTGGCATC
GGCGCCGGCCTCATTCGTCTCCACTTCCACGACTGCTTTGTTCAG
GTACACACATTATTATTACATGCATTACAACCACATTTGTCGACTCCCTCCAGCGACGACGCCGACGTGATTTTT
AATTTCATTTCATTCTCATCTCCGATCCATCATCAGGGATGCGATGCTTCCGTTCTCCTGAACACGACCGCATCAGGGAACAGCGACACGGAGAGGGAAGGCGGAGCCAACAAGAACAGC
CTGCGCGGCTTGGACGTGATCGACAAAGCCAAGGCCGCGCTGGAGAAGGCCTGCCCCAGCACGGCGGTCTCCTGCGCCGACATCCTCGCCTTCGCCGCGCGCGACGCCGCGCGCAACCTC
AGCGGCGGCAAGATCGAGTACAAGACGCCGGCCGGTCGCTGGGACGGGCGCGAGTCCTCCGCCGACGAGACAGGCACGCTGCCGGGGCCCTTCTCCCCCCTCGACACTCTCGTGGCCAAA
TTCGCCGACCAGGGGCTCAACCGGACCGACCTGGTGCTTCTCTCCGCCGCTCACTCCATCGGCCGCGCCCGCTGCATCTTCAGATCCAGCCGCCCGGGCATGAACCAGACCCTCGTCGAT
GACCTTAACGGGCAGTGCAAGAGTAACACCAGCAGTGTGAACCAAGACTACAAGACCCCTGACGTCCTGGACAGCCAGTACTACCAGAACGTGTTCGACAACGACGCGCTCTTCGACTCG
GACGCTGCGCTTACCAGCTCCATTTACACCAAAGCACTGGTGGAAACCTACAGGACTAACTTGATGAACCAGTTCGAGAAGGACTTTGGGGAAGCCATGGTGAAGATGGGCAAAATCAAG
ACTAAGACGAAAGGCGACAAGGACGTCGAGATAAGGAAGCAATGCTGGACTTACAACGCGCCTCCTAACTACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGGCAGCAGCTTGGAAGAATAAGCATGCTGCACTAATCATCACCGTGCTCGCGTTCCTCGCACCCATGGCGTGCCATGGCGGCGGCCTCATCAATTTCACTCTCCTCTGCTCGGGA
GGGTGGGTTCGCCCAATAACAGTCAGCCTCCCGCCGTTAGTGACCATCACGATCGGCTGTCCTAATAATGGCCCCAGCGAGGACCCCTATGTGCCTCCAAGTCCCAATCCCAACAACGAG
CCTGCTCCTCCCTCAGGAGCAGGGCTCTACTTGGACTACTACAATTACTCGTGCCCTAACGCCGAGACCATCGTCAGGGAGGTTGTGGAGGACGAGATCGCGAAACAGGGCCGTGGCATC
GGCGCCGGCCTCATTCGTCTCCACTTCCACGACTGCTTTGTTCAG
GGATGCGATGCTTCCGTTCTCCTGAACACGACCGCATCAGGGAACAGCGACACGGAGAGGGAAGGCGGAGCCAAC
AAGAACAGCCTGCGCGGCTTGGACGTGATCGACAAAGCCAAGGCCGCGCTGGAGAAGGCCTGCCCCAGCACGGCGGTCTCCTGCGCCGACATCCTCGCCTTCGCCGCGCGCGACGCCGCG
CGCAACCTCAGCGGCGGCAAGATCGAGTACAAGACGCCGGCCGGTCGCTGGGACGGGCGCGAGTCCTCCGCCGACGAGACAGGCACGCTGCCGGGGCCCTTCTCCCCCCTCGACACTCTC
GTGGCCAAATTCGCCGACCAGGGGCTCAACCGGACCGACCTGGTGCTTCTCTCCGCCGCTCACTCCATCGGCCGCGCCCGCTGCATCTTCAGATCCAGCCGCCCGGGCATGAACCAGACC
CTCGTCGATGACCTTAACGGGCAGTGCAAGAGTAACACCAGCAGTGTGAACCAAGACTACAAGACCCCTGACGTCCTGGACAGCCAGTACTACCAGAACGTGTTCGACAACGACGCGCTC
TTCGACTCGGACGCTGCGCTTACCAGCTCCATTTACACCAAAGCACTGGTGGAAACCTACAGGACTAACTTGATGAACCAGTTCGAGAAGGACTTTGGGGAAGCCATGGTGAAGATGGGC
AAAATCAAGACTAAGACGAAAGGCGACAAGGACGTCGAGATAAGGAAGCAATGCTGGACTTACAACGCGCCTCCTAACTACTGA

Retrieve as FASTA