Entry information : CgraCP01 (CgraKatG1)
Entry ID 8370
Creation 2011-05-10 (Marcel Zamocky)
Last sequence changes 2011-06-09 (Catherine Mathe)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-06-16 (Christophe Dunand)
Peroxidase information: CgraCP01 (CgraKatG1)
Name (synonym) CgraCP01 (CgraKatG1)
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Glomerellaceae Glomerella
Organism Colletotrichum graminicola (Glomerella graminicola)    [TaxId: 31870 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CgraCP01
start..stop
S start..stop
ChigCP01 1444 0 1..758 1..760
CfioCP01_MH18 1409 0 1..758 1..757
CfioCP01_PJ7 1407 0 1..758 1..757
CgloCP02_Naragc5 1338 0 1..758 1..757
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 473778..474107 330 N° 2 471770..473716 1947  
complement(join(471770..473716,473778..474107))


exon

Literature and cross-references CgraCP01 (CgraKatG1)
Literature Vaillancourt L., Ma L.-J., Thon M. et al. The genome sequence of Glomerella graminicola strain M1.001 (unpublished since 2009).
Protein ref. GenBank:   EFQ30677.1 UniProtKB:   E3QI62
DNA ref. GenBank:   GG697350.1 (471770..474107)
Protein sequence: CgraCP01 (CgraKatG1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   758
PWM (Da):   %s   83152.3  
PI (pH):   %s   6.13
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAEEKCPFIRTMNTGGGGTKNRDWWPNSLRLNILRQHTPVTNPLGGDFDYVSAFKGLDYDAIKKDLTALMTDSQEWWPADFGHYGGFFIRMAWHSAGTYRVHDGRGGGGEGQQRFAPLNSWPDNVSLDKARRLLWPIKQKYGNKISWADLMILTGNVALESMGFKTAGFSGGRPDTWEADESVYWGGETTWLGNDVRYSHGHRGKADSGVVDGSQSTKSDIHSRDLESPLGAAHMGLIYVNPEGPDGNPDPVAAARDIRITFGRMAMNDEETVALIAGGHSFGKTHGAAPDSNVGPEPEAAGLEAQGLGWHNKHGSGKGPDTITSGLEVTWTATPTKWSNKYFEYLFKFDWELTKSPAGANQWVAKNAEPIIPDAYDPNKKHLPTMLTTDLSLRFDPEYEKISRRFLENPDQFADAFAKAWFKLTHRDMGPRSRYVGPEVPSEEFIWQDPIPTPNHPLVNEQDAASLKKEILGTGIDPSKLISTAWASASTFRGSDKRGGANGARIRLAPQKDWEVNNPRQLAEVLKALESVQQKFNSSASGGKKISLADLIVLAGAAGVEQAARNAGYDITVPFTPGRGDASQEQTDIESVDHLQPFADGFRNYGKSTDRAKTEHYLVDRAHLLTLTAPELTVLLGGLRVLNTNFDGSSTGVFTSRPGALTTDFFVNLLDMGNEWKATSNEDVYEGYDRKSGSKKFTASRVDLIFGSHAELRAVAEIYAQADAGQKFVNDFVTTWNKVMNLDRFDLKNNSGSVASRL*

Retrieve as FASTA  
Remarks Complete from genomic (1 intron). No EST found. Strain="M1.001, FGSC 10212".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGAAGAGAAGTGCCCCTTCATCCGGACCATGAACACCGGCGGTGGCGGCACCAAGAATCGCGACTGGTGGCCCAACTCGCTCAGGCTCAACATCCTCCGCCAGCACACTCCCGTC
ACCAACCCGCTGGGCGGGGACTTCGACTATGTCTCCGCTTTCAAGGGTCTTGACTACGACGCCATCAAGAAGGACCTCACAGCCTTGATGACTGACTCCCAGGAATGGTGGCCCGCTGAC
TTTGGCCACTACGGTGGTTTCTTCATCCGCATGGCGTGGCACAGCGCTGGCACTTACCGTGTCCACGACGGACGCGGCGGTGGTGGCGAG
GTACGTTGGCCTGCCTTGTTGCTCATTCAC
CAGCCATCTTTCTAACCACCTTCTCCTACAGGGCCAGCAACGATTTGCTCCTCTTAACAGCTGGCCGGACAATGTCAGTCTCGATAAGGCCCGCCGCCTTCTGTGGCCCATTAAGCAAAA
GTACGGCAACAAGATCTCTTGGGCCGATCTCATGATTCTGACTGGCAATGTCGCGCTCGAGTCCATGGGCTTTAAGACCGCCGGTTTCTCTGGTGGTCGCCCAGACACTTGGGAGGCCGA
CGAGTCTGTCTACTGGGGTGGCGAGACCACTTGGCTGGGCAACGATGTTCGCTACTCCCATGGACACCGCGGTAAAGCCGATTCGGGCGTCGTGGATGGCTCTCAGTCCACAAAGTCTGA
CATCCACTCTCGCGATCTTGAGTCACCCCTCGGTGCTGCTCACATGGGTCTCATCTACGTGAACCCCGAAGGCCCTGACGGCAATCCTGATCCGGTTGCTGCCGCCAGAGACATCCGTAT
CACTTTTGGTCGTATGGCTATGAACGACGAAGAGACTGTCGCTCTCATTGCTGGTGGTCACTCCTTCGGCAAGACCCACGGCGCTGCTCCCGATAGCAATGTCGGCCCTGAGCCCGAGGC
TGCTGGTCTCGAGGCACAGGGTCTTGGCTGGCACAACAAGCACGGCTCCGGAAAGGGCCCCGATACCATCACCAGCGGCCTCGAGGTGACCTGGACCGCCACGCCCACCAAGTGGAGCAA
CAAGTACTTCGAGTATCTCTTCAAGTTTGACTGGGAGCTTACTAAGAGCCCTGCTGGCGCAAACCAGTGGGTGGCGAAGAATGCCGAGCCCATCATCCCCGATGCCTACGACCCCAACAA
GAAGCATTTGCCTACAATGCTGACAACTGACTTGTCGCTGCGCTTCGACCCCGAGTATGAGAAGATTTCGAGACGCTTCCTCGAGAACCCGGATCAGTTTGCCGACGCCTTTGCCAAGGC
TTGGTTCAAGCTGACACACCGTGACATGGGCCCGCGCTCCCGCTACGTCGGGCCTGAGGTTCCTTCCGAAGAATTCATCTGGCAGGACCCCATTCCCACCCCCAACCATCCTCTCGTCAA
TGAACAGGATGCTGCGTCTCTGAAGAAGGAGATCCTTGGCACCGGCATCGACCCCTCTAAGCTCATCTCAACTGCTTGGGCTTCTGCATCTACCTTCCGCGGCAGCGACAAGCGTGGTGG
TGCCAACGGCGCCCGCATCCGCCTGGCACCCCAGAAGGATTGGGAGGTGAACAATCCCAGGCAGCTTGCTGAGGTTCTCAAGGCTCTCGAGAGCGTTCAACAGAAATTCAACAGCTCTGC
GAGTGGTGGCAAGAAGATCTCGCTGGCTGACCTCATTGTCTTGGCCGGTGCTGCTGGTGTGGAGCAGGCCGCAAGGAACGCTGGCTACGATATCACCGTTCCCTTCACTCCCGGCCGTGG
TGATGCTTCCCAGGAGCAGACTGATATCGAGTCTGTCGACCACCTTCAGCCCTTCGCCGACGGCTTCCGTAACTACGGCAAGTCGACTGACCGTGCGAAGACGGAGCACTACCTTGTTGA
CCGCGCCCACCTGCTCACTCTCACCGCCCCTGAGCTCACCGTTCTGCTCGGCGGTCTGCGCGTGCTGAACACCAACTTCGACGGGTCGTCAACTGGTGTTTTTACTAGCCGCCCTGGGGC
CCTGACCACCGACTTCTTCGTCAACCTGCTTGACATGGGTAACGAGTGGAAGGCTACCAGCAACGAGGATGTGTACGAGGGCTACGACCGCAAGTCAGGCAGTAAGAAGTTTACCGCTAG
CCGTGTCGATCTCATCTTCGGTTCTCACGCCGAGCTCCGCGCCGTGGCTGAGATCTACGCCCAGGCCGACGCTGGACAAAAGTTTGTCAACGACTTTGTCACTACCTGGAACAAGGTCAT
GAACTTGGATCGTTTCGACCTCAAGAACAACAGTGGCAGCGTAGCCAGCCGTCTTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGAAGAGAAGTGCCCCTTCATCCGGACCATGAACACCGGCGGTGGCGGCACCAAGAATCGCGACTGGTGGCCCAACTCGCTCAGGCTCAACATCCTCCGCCAGCACACTCCCGTC
ACCAACCCGCTGGGCGGGGACTTCGACTATGTCTCCGCTTTCAAGGGTCTTGACTACGACGCCATCAAGAAGGACCTCACAGCCTTGATGACTGACTCCCAGGAATGGTGGCCCGCTGAC
TTTGGCCACTACGGTGGTTTCTTCATCCGCATGGCGTGGCACAGCGCTGGCACTTACCGTGTCCACGACGGACGCGGCGGTGGTGGCGAG
GGCCAGCAACGATTTGCTCCTCTTAACAGC
TGGCCGGACAATGTCAGTCTCGATAAGGCCCGCCGCCTTCTGTGGCCCATTAAGCAAAAGTACGGCAACAAGATCTCTTGGGCCGATCTCATGATTCTGACTGGCAATGTCGCGCTCGAG
TCCATGGGCTTTAAGACCGCCGGTTTCTCTGGTGGTCGCCCAGACACTTGGGAGGCCGACGAGTCTGTCTACTGGGGTGGCGAGACCACTTGGCTGGGCAACGATGTTCGCTACTCCCAT
GGACACCGCGGTAAAGCCGATTCGGGCGTCGTGGATGGCTCTCAGTCCACAAAGTCTGACATCCACTCTCGCGATCTTGAGTCACCCCTCGGTGCTGCTCACATGGGTCTCATCTACGTG
AACCCCGAAGGCCCTGACGGCAATCCTGATCCGGTTGCTGCCGCCAGAGACATCCGTATCACTTTTGGTCGTATGGCTATGAACGACGAAGAGACTGTCGCTCTCATTGCTGGTGGTCAC
TCCTTCGGCAAGACCCACGGCGCTGCTCCCGATAGCAATGTCGGCCCTGAGCCCGAGGCTGCTGGTCTCGAGGCACAGGGTCTTGGCTGGCACAACAAGCACGGCTCCGGAAAGGGCCCC
GATACCATCACCAGCGGCCTCGAGGTGACCTGGACCGCCACGCCCACCAAGTGGAGCAACAAGTACTTCGAGTATCTCTTCAAGTTTGACTGGGAGCTTACTAAGAGCCCTGCTGGCGCA
AACCAGTGGGTGGCGAAGAATGCCGAGCCCATCATCCCCGATGCCTACGACCCCAACAAGAAGCATTTGCCTACAATGCTGACAACTGACTTGTCGCTGCGCTTCGACCCCGAGTATGAG
AAGATTTCGAGACGCTTCCTCGAGAACCCGGATCAGTTTGCCGACGCCTTTGCCAAGGCTTGGTTCAAGCTGACACACCGTGACATGGGCCCGCGCTCCCGCTACGTCGGGCCTGAGGTT
CCTTCCGAAGAATTCATCTGGCAGGACCCCATTCCCACCCCCAACCATCCTCTCGTCAATGAACAGGATGCTGCGTCTCTGAAGAAGGAGATCCTTGGCACCGGCATCGACCCCTCTAAG
CTCATCTCAACTGCTTGGGCTTCTGCATCTACCTTCCGCGGCAGCGACAAGCGTGGTGGTGCCAACGGCGCCCGCATCCGCCTGGCACCCCAGAAGGATTGGGAGGTGAACAATCCCAGG
CAGCTTGCTGAGGTTCTCAAGGCTCTCGAGAGCGTTCAACAGAAATTCAACAGCTCTGCGAGTGGTGGCAAGAAGATCTCGCTGGCTGACCTCATTGTCTTGGCCGGTGCTGCTGGTGTG
GAGCAGGCCGCAAGGAACGCTGGCTACGATATCACCGTTCCCTTCACTCCCGGCCGTGGTGATGCTTCCCAGGAGCAGACTGATATCGAGTCTGTCGACCACCTTCAGCCCTTCGCCGAC
GGCTTCCGTAACTACGGCAAGTCGACTGACCGTGCGAAGACGGAGCACTACCTTGTTGACCGCGCCCACCTGCTCACTCTCACCGCCCCTGAGCTCACCGTTCTGCTCGGCGGTCTGCGC
GTGCTGAACACCAACTTCGACGGGTCGTCAACTGGTGTTTTTACTAGCCGCCCTGGGGCCCTGACCACCGACTTCTTCGTCAACCTGCTTGACATGGGTAACGAGTGGAAGGCTACCAGC
AACGAGGATGTGTACGAGGGCTACGACCGCAAGTCAGGCAGTAAGAAGTTTACCGCTAGCCGTGTCGATCTCATCTTCGGTTCTCACGCCGAGCTCCGCGCCGTGGCTGAGATCTACGCC
CAGGCCGACGCTGGACAAAAGTTTGTCAACGACTTTGTCACTACCTGGAACAAGGTCATGAACTTGGATCGTTTCGACCTCAAGAACAACAGTGGCAGCGTAGCCAGCCGTCTTTAA

Retrieve as FASTA