Entry information : TviCP02 (TviKatG2)
Entry ID 8376
Creation 2011-05-12 (Christophe Dunand)
Last sequence changes 2011-05-19 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2013-09-06 (Catherine Mathe (Scipio))
Peroxidase information: TviCP02 (TviKatG2)
Name (synonym) TviCP02 (TviKatG2)
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Hypocreaceae Hypocrea
Organism Trichoderma virens    [TaxId: 29875 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TviCP02
start..stop
S start..stop
TharCP02 1474 0 1..793 1..793
HjCP02 1446 0 1..793 1..792
TatCP02 1366 0 1..793 1..794
TaspCP01 1363 0 1..793 1..795
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 461374..461698 325 N° 2 461086..461313 228 N° 3 460424..461008 585 N° 4 460119..460361 243
N° 5 459733..460058 326 N° 6 459479..459668 190 N° 7 458923..459407 485  
complement(join(458923..459407,459479..459668,459733..460058,460119..460361,4604 24..461008,461086..461313,461374..461698))


exon

Literature and cross-references TviCP02 (TviKatG2)
Literature Kubicek C.P., Baker S.E., Gamauf C., Kenerley,C.P., Druzhinina,I.S.
Purifying selection and birth-and-death evolution in the class II hydrophobin gene families of the ascomyceteous genus Trichoderma/Hypocrea. (unpublished since 2007)

DNA ref. JGI genome:   scaffold_1 (461698..458923)
Protein sequence: TviCP02 (TviKatG2)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   793 (775)
PWM (Da):   %s   85346.79 (83573.7)  
PI (pH):   %s   6.12 (5.98) Peptide Signal:   %s   cut: 19 range:19-793
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPLKNILAIVGALPLASAAGCPHINGNSNVHVARSGFQHPESILESRFSPDGPDFGSCPRKSTVAGGGTRSRQWWPCELNLAVLRQFSEKSNPFGSDFDYASAFSKVDVAQLKKDITAVQTTSQDWWPADFGDYGPFFIRLAWHNAGTYRAIDGRGGAGQGQQRFAPLNSWPDNANLDKARRLLWPIKQKYGSALSWADLFVFAGNTAMENMGFPTYGFGFGRVDTWQSDEGIYWGGEQEMFPEALNNVVRYNGSTDFTTRADELESPLGAVSMGLIYVDPRGPNGTPDTKASALDIRETFGRMGMDDEETVALIAGGHAFGKTHGAVTGDHIGPEPNAADIELQGLGWKNSAVPGNGVNSYTSGLEVIWSRTPTKWANEFLFSLLNNNFTLTKSPDGAPQWEALDANASYPDPFIPGKFRRPTMLTSDLGLRDDPVYNNISKTFLNDFDYFTKKFGLAWYKLLHRDMGPIARYLGPEVPKQAPLIWQDPLPNATYKTLAASDISSLKSQILAAPGLNVSNLVTTAWGSASTFRISDKRGGANGARIALQPQASFAANNPPRLAAVIKLKGVQTKFQSSGKKVSLADLIVLGGAAAIEKAAKAAGITLTVPFTPGRVDATQDQTDVSTFAFLEPKADGFRNFGHGTASSLTEELLVDKAALLTLSPPELTVLIGGMRALSANFDGSSTGILTSHPGQLTNDFFVNLLGSYASWSVVPNTNSELFQSTDSTGKVQWTASRADLIFGSHPELRAVAEVYGSSDAKNKFANDFVAAWAKVMDLDRYDVSGHSGPY

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTCTCAAGAACATCTTGGCCATTGTCGGCGCTCTGCCGCTGGCCTCTGCCGCTGGCTGCCCTCACATCAATGGCAACAGCAACGTTCACGTTGCCCGCAGTGGCTTTCAACACCCC
GAGTCCATCCTGGAGTCGAGATTTAGCCCCGATGGCCCTGATTTCGGCTCGTGCCCCCGCAAGAGCACCGTTGCTGGTGGCGGCACTCGAAGCAGGCAGTGGTGGCCTTGTGAGCTGAAC
TTGGCCGTGCTTCGCCAGTTCTCTGAGAAGTCCAACCCCTTTGGCTCTGACTTTGACTATGCCAGCGCCTTCTCCAAGGTCGATG
GTAAGTTTGCTGCCCCATAAAATGTTTAAGCTTAC
AAGTGCCGATGTTGATATCCGACAGTCGCTCAACTCAAGAAGGACATCACTGCCGTGCAGACCACCTCTCAGGACTGGTGGCCCGCCGACTTTGGCGACTACGGTCCCTTCTTCATCCGT
CTTGCGTGGCACAACGCTGGTACCTACCGCGCCATTGATGGACGTGGAGGTGCCGGTCAGGGCCAGCAGAGGTTTGCTCCTCTCAACAGCTGGCCTGACAACGCCAACCTTGACAAGGCT
CGCCGCCTGCTTT
GTAAGTTGGCCCCTCAAACGATGAAGCCCGAAATGGCATGCAGGCGTTAAATTAAACATAATTCTAACCAAATTCAGGGCCCATCAAGCAAAAGTATGGCAGCGCCC
TCTCTTGGGCTGACTTGTTCGTCTTCGCCGGCAACACTGCCATGGAGAACATGGGCTTCCCCACGTATGGTTTCGGCTTTGGTCGTGTGGATACCTGGCAGTCCGACGAGGGTATCTACT
GGGGTGGCGAGCAAGAGATGTTCCCTGAGGCTCTGAACAACGTGGTCCGCTACAACGGAAGCACAGACTTCACTACTCGTGCGGACGAACTCGAAAGCCCGCTTGGAGCTGTCAGCATGG
GTCTCATCTACGTTGACCCCCGCGGACCCAACGGTACCCCTGACACCAAGGCTTCTGCCCTTGATATCCGTGAGACCTTCGGCCGCATGGGTATGGACGATGAGGAGACCGTTGCCCTGA
TTGCTGGTGGTCACGCCTTCGGCAAGACCCACGGTGCCGTTACTGGCGACCACATCGGTCCTGAGCCCAACGCTGCCGACATTGAGCTCCAGGGTCTTGGATGGAAGAACAGCGCTGTCC
CTGGCAACGGTGTGAACTCATACACCAGTGGTCTCGAGGTCATCTGGTCCCGAACTCCCACCAAGTGGGCCAATG
GTGAGTATCTTGCATCTTTTCGGGTGATCAACAACTAAGACACGC
ACTAACGTTTCTGTCAGAGTTCCTCTTCTCCCTGCTCAACAACAACTTCACCCTCACTAAGTCCCCCGATGGTGCTCCCCAGTGGGAGGCTCTCGATGCCAACGCGTCCTACCCCGACCC
CTTCATCCCGGGCAAGTTCCGCCGCCCTACTATGTTGACCAGTGATCTTGGTCTTCGTGATGACCCCGTCTACAACAACATCTCCAAGACCTTCCTCAACGACTTTGACTACTTCACCAA
GAAGTTCGGTCTTGCCTGGT
GTAAGTAAACCCATCAACTCAATTGGAGAAATGGTTGAGGCCTAACTGAGCTCGATATAGACAAGCTTCTCCACCGTGACATGGGCCCCATCGCCCGCTA
CCTCGGCCCTGAAGTCCCCAAGCAGGCTCCTCTGATCTGGCAGGACCCTCTCCCCAATGCCACTTACAAGACTCTGGCCGCCTCTGATATCTCATCCCTGAAGTCTCAGATTCTCGCCGC
CCCCGGCCTGAACGTCTCCAACTTGGTCACCACTGCCTGGGGATCTGCCTCTACCTTCCGTATCTCTGACAAGCGTGGTGGTGCCAACGGTGCCCGCATTGCCCTCCAGCCCCAGGCTTC
TTTCGCTGCCAACAACCCCCCTCGTCTGGCTGCTGTCATCAAGGCT
GTATGTGAAGATGTTTCTGTGTCTGTACTGTATAAGTGCTTTGCTAATACAATTCGACCTGCAGCTCAAGGGAG
TCCAGACCAAGTTCCAGTCCAGCGGCAAGAAGGTTTCTCTGGCTGATCTCATTGTTCTCGGTGGTGCTGCTGCCATTGAGAAGGCTGCCAAGGCTGCCGGGATCACTCTTACCGTGCCAT
TCACCCCTGGTCGTGTCGATGCCACCCAAGATCAGACCGATGTCTCCACCTTCGCTTTCC
GTGAGTCCTATCCCCTTATGGCAATCTTATCGTGGCCTGCATGAATGACGCTGACTATTT
TTGTGCTTTAGTTGAGCCCAAGGCTGACGGTTTCCGCAACTTTGGCCACGGCACCGCTTCATCTCTCACTGAGGAGCTCTTGGTCGACAAGGCTGCCCTCCTGACCCTGAGCCCTCCTGA
GCTGACTGTCCTCATTGGCGGTATGCGTGCCCTCTCTGCCAACTTTGACGGCTCCTCCACCGGTATCCTCACCAGCCACCCTGGCCAGCTCACCAACGACTTCTTCGTCAACCTTTTGGG
TTCATATGCCAGCTGGTCCGTCGTCCCCAACACCAACTCGGAGCTGTTCCAGAGCACGGATTCTACCGGCAAGGTCCAGTGGACTGCTTCTCGTGCTGATCTCATCTTCGGCTCTCACCC
TGAGCTCCGTGCCGTTGCTGAGGTCTACGGTTCTTCTGATGCCAAGAACAAGTTCGCCAATGACTTTGTCGCTGCTTGGGCCAAGGTCATGGACCTTGACCGCTATGATGTCAGCGGACA
CTCTGGTCCTTACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTCTCAAGAACATCTTGGCCATTGTCGGCGCTCTGCCGCTGGCCTCTGCCGCTGGCTGCCCTCACATCAATGGCAACAGCAACGTTCACGTTGCCCGCAGTGGCTTTCAACACCCC
GAGTCCATCCTGGAGTCGAGATTTAGCCCCGATGGCCCTGATTTCGGCTCGTGCCCCCGCAAGAGCACCGTTGCTGGTGGCGGCACTCGAAGCAGGCAGTGGTGGCCTTGTGAGCTGAAC
TTGGCCGTGCTTCGCCAGTTCTCTGAGAAGTCCAACCCCTTTGGCTCTGACTTTGACTATGCCAGCGCCTTCTCCAAGGTCGATG
TCGCTCAACTCAAGAAGGACATCACTGCCGTGCAG
ACCACCTCTCAGGACTGGTGGCCCGCCGACTTTGGCGACTACGGTCCCTTCTTCATCCGTCTTGCGTGGCACAACGCTGGTACCTACCGCGCCATTGATGGACGTGGAGGTGCCGGTCAG
GGCCAGCAGAGGTTTGCTCCTCTCAACAGCTGGCCTGACAACGCCAACCTTGACAAGGCTCGCCGCCTGCTTT
GGCCCATCAAGCAAAAGTATGGCAGCGCCCTCTCTTGGGCTGACTTG
TTCGTCTTCGCCGGCAACACTGCCATGGAGAACATGGGCTTCCCCACGTATGGTTTCGGCTTTGGTCGTGTGGATACCTGGCAGTCCGACGAGGGTATCTACTGGGGTGGCGAGCAAGAG
ATGTTCCCTGAGGCTCTGAACAACGTGGTCCGCTACAACGGAAGCACAGACTTCACTACTCGTGCGGACGAACTCGAAAGCCCGCTTGGAGCTGTCAGCATGGGTCTCATCTACGTTGAC
CCCCGCGGACCCAACGGTACCCCTGACACCAAGGCTTCTGCCCTTGATATCCGTGAGACCTTCGGCCGCATGGGTATGGACGATGAGGAGACCGTTGCCCTGATTGCTGGTGGTCACGCC
TTCGGCAAGACCCACGGTGCCGTTACTGGCGACCACATCGGTCCTGAGCCCAACGCTGCCGACATTGAGCTCCAGGGTCTTGGATGGAAGAACAGCGCTGTCCCTGGCAACGGTGTGAAC
TCATACACCAGTGGTCTCGAGGTCATCTGGTCCCGAACTCCCACCAAGTGGGCCAATG
AGTTCCTCTTCTCCCTGCTCAACAACAACTTCACCCTCACTAAGTCCCCCGATGGTGCTCCC
CAGTGGGAGGCTCTCGATGCCAACGCGTCCTACCCCGACCCCTTCATCCCGGGCAAGTTCCGCCGCCCTACTATGTTGACCAGTGATCTTGGTCTTCGTGATGACCCCGTCTACAACAAC
ATCTCCAAGACCTTCCTCAACGACTTTGACTACTTCACCAAGAAGTTCGGTCTTGCCTGGT
ACAAGCTTCTCCACCGTGACATGGGCCCCATCGCCCGCTACCTCGGCCCTGAAGTCCCC
AAGCAGGCTCCTCTGATCTGGCAGGACCCTCTCCCCAATGCCACTTACAAGACTCTGGCCGCCTCTGATATCTCATCCCTGAAGTCTCAGATTCTCGCCGCCCCCGGCCTGAACGTCTCC
AACTTGGTCACCACTGCCTGGGGATCTGCCTCTACCTTCCGTATCTCTGACAAGCGTGGTGGTGCCAACGGTGCCCGCATTGCCCTCCAGCCCCAGGCTTCTTTCGCTGCCAACAACCCC
CCTCGTCTGGCTGCTGTCATCAAGGCT
CTCAAGGGAGTCCAGACCAAGTTCCAGTCCAGCGGCAAGAAGGTTTCTCTGGCTGATCTCATTGTTCTCGGTGGTGCTGCTGCCATTGAGAAG
GCTGCCAAGGCTGCCGGGATCACTCTTACCGTGCCATTCACCCCTGGTCGTGTCGATGCCACCCAAGATCAGACCGATGTCTCCACCTTCGCTTTCC
TTGAGCCCAAGGCTGACGGTTTC
CGCAACTTTGGCCACGGCACCGCTTCATCTCTCACTGAGGAGCTCTTGGTCGACAAGGCTGCCCTCCTGACCCTGAGCCCTCCTGAGCTGACTGTCCTCATTGGCGGTATGCGTGCCCTC
TCTGCCAACTTTGACGGCTCCTCCACCGGTATCCTCACCAGCCACCCTGGCCAGCTCACCAACGACTTCTTCGTCAACCTTTTGGGTTCATATGCCAGCTGGTCCGTCGTCCCCAACACC
AACTCGGAGCTGTTCCAGAGCACGGATTCTACCGGCAAGGTCCAGTGGACTGCTTCTCGTGCTGATCTCATCTTCGGCTCTCACCCTGAGCTCCGTGCCGTTGCTGAGGTCTACGGTTCT
TCTGATGCCAAGAACAAGTTCGCCAATGACTTTGTCGCTGCTTGGGCCAAGGTCATGGACCTTGACCGCTATGATGTCAGCGGACACTCTGGTCCTTACTAA

Retrieve as FASTA