Entry information : AbraCP01
Entry ID 8379
Creation 2011-05-13 (Christophe Dunand)
Last sequence changes 2012-04-23 (Catherine Mathe (Scipio))
Sequence status partial
Reviewer Marcel Zamocky
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: AbraCP01
Name AbraCP01
Class Catalase peroxidase     [Orthogroup: CP001]*
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Pleosporaceae Alternaria
Organism Alternaria brassicicola    [TaxId: 29001 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AbraCP01
start..stop
S start..stop
AalteCP01 1408 0 1..717 1..717
PterCP 1373 0 1..716 1..716
PtritCP01 1363 0 1..716 1..716
SturCP 1354 0 1..716 1..715
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 37616..38354 739 N° 2 36154..37565 1412  
complement(join(36154..37565,37616..38354))


exon

Literature and cross-references AbraCP01
Literature Clifton,S., Fulton,L., Fulton,B., Godfrey,J., Minx,P. and Nelson,J.
Draft sequence assembly of the Alternaria brassicicola genome (unpublished since 2009)
DNA ref. JGI genome:   Contig11 (38354..36154)
Protein sequence: AbraCP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   717
PWM (Da):   %s   79252.65  
PI (pH):   %s   6.14
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSQGECPAKKTPNVAGAGTRNADWWPNELRVNILRQHDPRQNPLGPDFNYVEEFKKLDYNALKKDINALMTDSQDWWPADFGHYGGLFVRMAWHSAGTYRVTDGRGGGGEGQQRFAPLNSWPDNVSLDKARRLLWPIKQKYGNKISWADLILLTGNVALESMGCPTFGFAGGRADTFQSDESVYWGGETEWLGSDVRYADGAKGVKGEGIVDGDQHKVNKDETHTARDLEKPLAASHMGLIYVNPEGPDGVPDPVAAAHDIRTTFSRMAMNDEETAALIIGGHSFGKTHGAAPSENTGPDPNSEDLATQGLGWMNKHGRGNGPDTITSGLEVTWTSTPTKWSNKYLEYLYKFEWELEKSPAGANQWVAKTDDKIIPDAYDQAKKHKPRMLTTDLSMRMDPTYEKITRRWLDHPEELHDTFVRAWFKLLHRDMGPRSRWLGPEVPKEVLIWEDPVPQPEGEIIGDAEISTLKKQILDAGIEPAKLIRTAWASAASFRGSDKRGGANGARIRLAPQKDWEVNNPKELAEVLKALEGIQSKFNGGSKKVSLADLIVLAGTAAVEKAAGVPVPFTPGRTDASQEQTDVQSFEHLEPVTDGFRNSGKGTDRARTEQLDVDKAHLLRLTAPEMTVLTGGMRALNANWDGSSHGIFTKRPGQLTNDFFVNLLDNNTEWKATDASKELYEGIDRKSGQKKWTATRHDLVFGAHPELRAIAETYA

Retrieve as FASTA  
Remarks Partial sequence from genomic (1 intron). Short 3' end is missing.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTCAAGGCGAGTGTCCCGCAAAGAAGACGCCCAACGTCGCCGGCGCCGGTACCAGGAACGCCGACTGGTGGCCAAATGAGCTCAGGGTCAACATCCTGCGCCAACATGACCCCAGG
CAGAACCCCCTCGGTCCTGACTTCAACTATGTTGAGGAGTTCAAGAAGCTCGACTACAATGCATTGAAGAAGGACATCAACGCCCTGATGACCGACTCCCAGGACTGGTGGCCTGCTGAC
TTTGGCCACTATGGTGGTCTTTTCGTCCGTATGGCATGGCACTCTGCTGGTACCTACCGTGTTACCGACGGTCGTGGTGGTGGTGGCGAGGGACAGCAGCGCTTTGCTCCCCTCAACTCA
TGGCCCGACAACGTTTCTCTCGACAAGGCCCGCCGCCTCCTCTGGCCCATCAAGCAGAAGTACGGCAACAAGATTTCTTGGGCCGACTTGATTCTCCTTACCGGCAACGTCGCCCTTGAG
TCCATGGGCTGCCCAACCTTCGGTTTCGCTGGTGGCCGCGCCGACACTTTCCAGTCTGATGAGTCTGTCTACTGGGGTGGCGAGACTGAGTGGCTCGGCAGTGACGTCCGCTACGCTGAT
GGCGCCAAGGGTGTCAAGGGCGAGGGCATCGTGGACGGTGACCAACACAAGGTCAACAAGGACGAGACCCACACAGCGAGAGATCTCGAGAAGCCCTTGGCGGCCTCACACATGGGTCTC
ATCTACGTGAACCCAGAAG
GTAAGCATACCTGGTCAAATGTCTAGGTTCTATCCATCTAACCTTTCCAGGTCCCGACGGTGTTCCCGACCCCGTTGCCGCCGCTCACGACATCCGAACAA
CCTTTAGCCGCATGGCCATGAATGACGAGGAGACCGCCGCCCTCATCATCGGCGGCCACTCTTTCGGAAAGACCCACGGCGCTGCTCCTTCGGAAAATACTGGTCCAGACCCCAACTCTG
AGGATCTTGCAACACAAGGACTTGGCTGGATGAACAAGCATGGCCGTGGTAACGGTCCCGACACCATCACCAGTGGTCTCGAGGTCACCTGGACTAGCACACCCACCAAGTGGAGCAACA
AGTACCTTGAGTACCTCTACAAGTTCGAGTGGGAGCTAGAGAAGAGCCCTGCTGGTGCAAACCAGTGGGTCGCTAAGACCGACGACAAGATCATTCCTGACGCCTATGACCAGGCCAAGA
AGCACAAGCCAAGGATGTTGACCACCGACTTGTCGATGCGCATGGACCCAACCTACGAGAAGATCACTCGTCGCTGGTTGGACCACCCCGAGGAGCTTCACGACACGTTCGTGCGCGCGT
GGTTCAAGCTTCTCCACCGTGACATGGGTCCCCGCTCCAGGTGGTTGGGCCCCGAGGTCCCCAAGGAGGTCCTTATTTGGGAAGACCCTGTTCCGCAGCCCGAGGGCGAGATCATTGGCG
ACGCTGAGATCTCCACTCTGAAGAAGCAGATCCTTGACGCTGGCATTGAGCCCGCTAAGCTCATTCGCACTGCTTGGGCTTCAGCAGCCTCTTTCCGTGGCAGCGACAAGCGTGGAGGTG
CCAACGGTGCCCGTATCCGCCTCGCTCCTCAGAAGGACTGGGAGGTCAACAACCCCAAGGAGCTTGCCGAGGTCCTCAAGGCTCTCGAGGGTATTCAGTCTAAGTTCAACGGTGGCAGCA
AAAAGGTTTCTCTGGCCGACTTGATTGTCTTGGCCGGTACCGCTGCCGTCGAGAAGGCCGCCGGTGTACCTGTTCCTTTCACACCTGGCCGCACCGACGCCTCGCAGGAGCAGACTGACG
TGCAGTCTTTCGAGCACCTCGAGCCCGTCACTGACGGTTTCCGTAACTCTGGAAAGGGTACCGATCGTGCCCGCACCGAGCAACTCGATGTCGACAAGGCCCATCTCCTCCGCCTCACTG
CCCCTGAGATGACTGTCCTTACCGGCGGTATGCGTGCATTGAATGCCAATTGGGATGGCTCATCCCACGGCATCTTCACCAAGCGTCCTGGTCAGCTCACCAACGACTTCTTCGTCAACC
TCCTCGACAACAACACCGAGTGGAAGGCAACCGACGCAAGCAAGGAGCTGTACGAGGGCATCGACCGCAAGTCTGGCCAGAAGAAGTGGACCGCCACCCGTCACGACCTCGTCTTCGGGG
CTCATCCCGAACTTCGTGCGATCGCCGAGACTTACGCGTCA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTCAAGGCGAGTGTCCCGCAAAGAAGACGCCCAACGTCGCCGGCGCCGGTACCAGGAACGCCGACTGGTGGCCAAATGAGCTCAGGGTCAACATCCTGCGCCAACATGACCCCAGG
CAGAACCCCCTCGGTCCTGACTTCAACTATGTTGAGGAGTTCAAGAAGCTCGACTACAATGCATTGAAGAAGGACATCAACGCCCTGATGACCGACTCCCAGGACTGGTGGCCTGCTGAC
TTTGGCCACTATGGTGGTCTTTTCGTCCGTATGGCATGGCACTCTGCTGGTACCTACCGTGTTACCGACGGTCGTGGTGGTGGTGGCGAGGGACAGCAGCGCTTTGCTCCCCTCAACTCA
TGGCCCGACAACGTTTCTCTCGACAAGGCCCGCCGCCTCCTCTGGCCCATCAAGCAGAAGTACGGCAACAAGATTTCTTGGGCCGACTTGATTCTCCTTACCGGCAACGTCGCCCTTGAG
TCCATGGGCTGCCCAACCTTCGGTTTCGCTGGTGGCCGCGCCGACACTTTCCAGTCTGATGAGTCTGTCTACTGGGGTGGCGAGACTGAGTGGCTCGGCAGTGACGTCCGCTACGCTGAT
GGCGCCAAGGGTGTCAAGGGCGAGGGCATCGTGGACGGTGACCAACACAAGGTCAACAAGGACGAGACCCACACAGCGAGAGATCTCGAGAAGCCCTTGGCGGCCTCACACATGGGTCTC
ATCTACGTGAACCCAGAAG
GTCCCGACGGTGTTCCCGACCCCGTTGCCGCCGCTCACGACATCCGAACAACCTTTAGCCGCATGGCCATGAATGACGAGGAGACCGCCGCCCTCATCATC
GGCGGCCACTCTTTCGGAAAGACCCACGGCGCTGCTCCTTCGGAAAATACTGGTCCAGACCCCAACTCTGAGGATCTTGCAACACAAGGACTTGGCTGGATGAACAAGCATGGCCGTGGT
AACGGTCCCGACACCATCACCAGTGGTCTCGAGGTCACCTGGACTAGCACACCCACCAAGTGGAGCAACAAGTACCTTGAGTACCTCTACAAGTTCGAGTGGGAGCTAGAGAAGAGCCCT
GCTGGTGCAAACCAGTGGGTCGCTAAGACCGACGACAAGATCATTCCTGACGCCTATGACCAGGCCAAGAAGCACAAGCCAAGGATGTTGACCACCGACTTGTCGATGCGCATGGACCCA
ACCTACGAGAAGATCACTCGTCGCTGGTTGGACCACCCCGAGGAGCTTCACGACACGTTCGTGCGCGCGTGGTTCAAGCTTCTCCACCGTGACATGGGTCCCCGCTCCAGGTGGTTGGGC
CCCGAGGTCCCCAAGGAGGTCCTTATTTGGGAAGACCCTGTTCCGCAGCCCGAGGGCGAGATCATTGGCGACGCTGAGATCTCCACTCTGAAGAAGCAGATCCTTGACGCTGGCATTGAG
CCCGCTAAGCTCATTCGCACTGCTTGGGCTTCAGCAGCCTCTTTCCGTGGCAGCGACAAGCGTGGAGGTGCCAACGGTGCCCGTATCCGCCTCGCTCCTCAGAAGGACTGGGAGGTCAAC
AACCCCAAGGAGCTTGCCGAGGTCCTCAAGGCTCTCGAGGGTATTCAGTCTAAGTTCAACGGTGGCAGCAAAAAGGTTTCTCTGGCCGACTTGATTGTCTTGGCCGGTACCGCTGCCGTC
GAGAAGGCCGCCGGTGTACCTGTTCCTTTCACACCTGGCCGCACCGACGCCTCGCAGGAGCAGACTGACGTGCAGTCTTTCGAGCACCTCGAGCCCGTCACTGACGGTTTCCGTAACTCT
GGAAAGGGTACCGATCGTGCCCGCACCGAGCAACTCGATGTCGACAAGGCCCATCTCCTCCGCCTCACTGCCCCTGAGATGACTGTCCTTACCGGCGGTATGCGTGCATTGAATGCCAAT
TGGGATGGCTCATCCCACGGCATCTTCACCAAGCGTCCTGGTCAGCTCACCAACGACTTCTTCGTCAACCTCCTCGACAACAACACCGAGTGGAAGGCAACCGACGCAAGCAAGGAGCTG
TACGAGGGCATCGACCGCAAGTCTGGCCAGAAGAAGTGGACCGCCACCCGTCACGACCTCGTCTTCGGGGCTCATCCCGAACTTCGTGCGATCGCCGAGACTTACGCGTCA

Retrieve as FASTA