Entry information : EsilCP02 (Esi_0079_0050)
Entry ID 8387
Creation 2011-05-17 (Christophe Dunand)
Last sequence changes 2011-05-17 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2015-08-05 (Christophe Dunand)
Peroxidase information: EsilCP02 (Esi_0079_0050)
Name (synonym) EsilCP02 (Esi_0079_0050)
Class Catalase peroxidase    [Orthogroup: CP002]
Taxonomy Eukaryota Phaeophyceae Ectocarpaceae Ectocarpus
Organism Ectocarpus siliculosus    [TaxId: 2880 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EsilCP02
start..stop
S start..stop
EsilCP01 1225 0 1..699 1..700
EsilCP04 706 0 1..501 1..497
EsilCP04 74 0.00000000000006 457..554 87..189
PsojCP 693 0 10..689 9..682
PsojCP03 687 0 10..690 9..683
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 42180..42272 93 N° 2 40779..41352 574 N° 3 40121..40249 129 N° 4 39317..39648 332
N° 5 38514..38894 381 N° 6 37506..38138 633  
complement(join(37506..38138,38514..38894,39317..39648,40121..40249,40779..41352 ,42180..42272))


exon

Literature and cross-references EsilCP02 (Esi_0079_0050)
Protein ref. UniProtKB:   D7G6S2 [Incorrect prediction]
DNA ref. GenBank:   CABU01012501.1 (42272..37506)
Protein sequence: EsilCP02 (Esi_0079_0050)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   713 (691)
PWM (Da):   %s   76473.21 (74278.0) Transmb domain:   %s   i7-29o
PI (pH):   %s   3.84 (3.79) Peptide Signal:   %s   cut: 23 range:23-713
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGHKCRLGVLATLAFIASPASAGCPFLSGEKGSQADLNPGVDRALGSYDDDSSYYGGADFSRETYEALQEDITAMFTNSMDFWPADFGNYAPLMIRLAWHCNGNYRQSDGRGGCDGGRIRFNPERSWADNTNLDKALTLLQPIKLKYGDAVSWGDLITLTGNEAIRTMGGPVLGFCAGRLDDANGVDSLALGPSDEQEAVAPCAVNGTCEAPLGTSTVGLIYVNPEGPSGVPDPAGSAESIRDVFGRMGMNDSETVALIGGGHAFGKFHGACDTGPGADPIDAPEAPWPGTCGDVDSATFGRAENTFTSGFEGQWTVEPLVWDNQYFKDLLEYDWVMTESPADLVQWFPVLKEGATETEDEIPDIIMLTSDVALLDPEYLALCELFASDQAYLDTAFAAAWYKLTSRDMGQFQRCVGTDVAPPQDFQLPLPEAPTDLPDTDGAKSAIQSILSSDPSYPALFVTLAWQCASTHRSTDFLGGCNGARIRFSPEKDWAGNQGLDQVLSLLSPVQDDYPDVSYADLIVLAGNLALEIDLSFCAGRVDVTEGDDLISVLEPREYDDVIVGVRDRMRIRGLSVAQMVALAGRPRSASHMITLGFSGSYTSDDPPALSNAFYVTLLTETWEEVPGSDGQEYQAVGTSGVYVLATDLALVWDPEFKAQTVMYAEDNDQFLKEFASAWTAVMNADRYDGPTGNVCDDVSGDSDDDSSSDDH*

Retrieve as FASTA  
Remarks Complete sequence from genomic (5 introns) and 7 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTCACAAGTGTAGGCTCGGGGTCCTGGCCACGTTGGCGTTCATCGCTTCGCCTGCATCCGCCGGCTGCCCGTTCCTCTCTGGCGAAAAGGTAAGATGTAATCATGCTTGTAAGTGC
GGACGGACGCATGCCCCCGATGTACATACAGACTACGTTTTGTTTTTTGTGTGCTTTTCCTTTACTCAAGCTGTGGGCGGTGCGAAACTTAACAAATTGGGGTCGGATGCGAAAATTATC
GGGAACTGCTGTAGCGTGTCGCGTGTCGTTTCGACGTTGCTGCTGCTGCTTTTCAACCCAGGTTACTTACTTGCTGGGGGAAAGTGTTTTTCTTGCCATTCGTTCATGCCTGCAGTATTC
TTGTCACCTCTGTGTGGTAGACCTTCCAGGGGTTGGTCTTAACCCTTAACCGTTGAACCCTTTGACCAAGCTCCCGTCTTCGTGCAGCTGCCCTTGTCGTGTGCGCTCTGTCACGCTGTA
GTGGTGGGGCGCAAGTGTTTTTCCCGTTCTTGTTTCGGATCGGTCAAAATGCCTCGAGCGTCGAATCGTCGCACACCCTACGCCGTTGTTCTTCCTCGAGATGCCCCCAGTCAGCGAAAG
GTGCCAAGAATAAAGCTTTGGCCTGGAACCGGGGTCGCTATTCCCCGACAAACACGCAATATAACAACAAACTTTGCATGCGCTTGTGTCGCTGACTGCTTTGGTGAGGTCATAGGTTTC
AGCTTTGACGCTCAGACAGACGAGAGCGATGAGATTCAGCCTTGACACGCCTATTGAATGTGCACGCTCTCTTCGATCAACGGGGTTGATCATACCGTACCCTTCACCAGGATTCCCGGT
GAAATATTCTGGACAATGTTCTATGTGCACCTCCCTCCAACCGCCTCTCCTCCCTGCTCTCTCGTACCCACGCTTCACAGGGCTCGCAAGCCGACCTGAACCCCGGCGTGGACCGTGCTC
TGGGGTCCTACGACGATGATAGCAGCTACTATGGAGGTGCGGACTTCTCCCGCGAGACCTACGAAGCTCTTCAAGAGGACATCACGGCCATGTTCACCAACTCCATGGACTTCTGGCCGG
CCGACTTCGGCAACTATGCTCCCCTGATGATCCGCCTCGCCTGGCACTGCAACGGCAACTACCGCCAGTCGGACGGCCGCGGCGGCTGCGACGGTGGCCGGATCCGCTTCAACCCGGAAC
GCAGCTGGGCGGACAACACCAACCTAGACAAGGCGCTGACACTCCTGCAGCCCATCAAGCTCAAGTACGGCGACGCCGTCTCGTGGGGAGACCTCATCACCCTGACGGGTAACGAGGCGA
TCCGGACGATGGGCGGACCCGTGTTGGGGTTCTGCGCCGGAAGGCTTGACGATGCGAATGGCGTCGACAGCCTCGCGCTGGGCCCCTCTGACGAGCAGGAGGCCGTCGCTCCTTGCGCCG
TCAACGGGACTTGCGAAGCCCCTCTCGGCACCAGCACGGTGGGCTTGATCTACG
GTGAGTAGTCTACTGCTGTACTTCGTTTCTTGTGGGAATAGTTGGTTAGACTAGATGTTTGAAGCC
GCAAAGCCCCAACACACCATAAGGTTGGGTTGGCTTTTGAAGACACATACCCCAACAATCTAGAGCAAGTGTTGGAGCTTGCCCCCCCCTTCACCGACGTGTACCATGACACACGATTTC
ATTATTTCGACAGCGTTAAAAATGCGAGGCCCCTACCTCGCGATACTCCCAAGGGCTCACGATAATATCTCCGTGCGCCAGCCAAGCTAGATAGCCTTAGCTCGGGTATTGTTCAGTACT
ATTGACGAGTAGACCATTCCTTATGACCGTCGTAAAACCACGTACATCCTCGGATGACGTCCGCTTCAGTTGAGCTGTTATAGTACGGATAGTGGAAGCTGCTGAGCGGAGACCATAACG
TTTTTGTTCATGTCGACAAACAACATCACGTTTCTGGCGCATGTCACTCTTATGTACCTCCCCTGTTGAACCCCTTTACTGCAACTGTATGTATGTACCCCAGTGAACCCCGAGGGGCCC
TCCGGCGTTCCCGACCCCGCGGGCAGCGCTGAAAGCATCCGGGATGTCTTCGGGCGGATGGGCATGAACGACAGCGAGACAGTGGCTCTCATCGGAGGAGGGCACGCCTTCG
GTGAGTTA
GTTTGTGTAGGTTGACCGTGTCAGAGGCGGCAACGTACCATATACTAACTGTGGTTTGTTCAGTACGCGTCGATCCGGCAGGCGTCAACCTTCTTGTCTGTAGAAGCGCCTCGGCAGCTA
GACACGTATGCGGGTACACGGGTGACTGCTCAAAGAAGCGTCCGGGCGGTCGACTCGTGCCTGCGTTGCGCGTCTGTTTCGCTGTAGGTCCCCTTCCCGAACGTTCCGTCATCATTGATA
CAGAGTCCATCGTTCCCAAACTCCCAAAACCCCGATATTCCGCGCCCCTCCCCAACCTACCCAAGAGATGGGATCTCCGCAGCCCAAAGCAATCACCGTGTCTCTCACTGGCTTCGGAAC
TCCTCTTCCTCTTTCACGATGCTTCGCTGTATCTGCACTCGCATCGCTGACAATTTCGTCCCCCCATACGTTTTGTGTACGATCTCCCCCTCGGCTCCTGACAGGAAAGTTCCACGGCGC
GTGTGACACCGGGCCCGGCGCCGACCCGATCGACGCCCCCGAAGCCCCCTGGCCGGGAACATGCGGCGACGTCGACTCCGCGACCTTCGGCCGCGCCGAGAACACCTTCACGAGCGGGTT
CGAGGGCCAGTGGACGGTGGAGCCCCTGGTGTGGGACAACCAGTACTTCAAGGACCTCCTCGAGTACGACTGGGTGATGACGGAAAGCCCCGCCGACCTCGTGCAGTGGTTCCCGGTCCT
GAAGGAGGGGGCCACCGAGACGGAGGACGAGATCCCCGACATCATTATGCTCACCAGCGACGTCGCCTTGTTGTTT
GTGAGAGCGAAAGCGTCGGGTGTTTTTTTTTTATCGCCTGCGTA
AAGACTGAACGCTCAACACACTGCCGAACGGCCTACGTAGAATGTCGAACGGCTTACCGAGATAGAACGTGAGCTCCGCCGTTGAGACGTAAGGACTTTGTAGATTCCCTCGATTGCGTT
CAGAGCTTTGTTTGCGCGATACTACAGCATGTGCTCCACGAACTATCTCGCAGCCATCTCTTGTTCAGAAGCTTCGACTCCGGACGTGTGACTATACACTGTTCATGTATTCAACATCGC
CCGTCAGGAAAATAGCAGTATCAGTCGAAAGAATCCACACACTGTAGTCCACAACGTACGACAGACAAGTCAAAGGTTGAGTCGAAAAATTAACGCAGGTCTCCATCCGTGCCATGCTGT
CGCCCACTGCCCGCGCAGGACCCGGAATACCTCGCCCTTTGCGAACTCTTCGCCAGCGACCAGGCCTACCTTGACACCGCCTTCGCCGCGGCTTGGTACAAGCTCACCTCTCGCGACATG
GGCCAGTTCCAGCGCTGCGTGGGCACCGACGTGGCGCCGCCTCAGGACTTCCAGCTGCCGCTCCCGGAGGCGCCCACCGACCTCCCCGACACCGACGGGGCCAAGTCGGCGATCCAGAGC
ATCCTGTCCAGCGACCCGTCCTACCCCGCCCTATTCGTCACCCTGGCCTGGCAGTGCGCGTCCACCCACCGCTCGACCGACTTCTTGGGCGGCTGCAATGGGGCGAGGATCCGATTCTCT
CCCGAGAAGGACTGGGCCGGAAACCAGGGTCTCGACCAG
GTGAGAGGTGTAAGAGTCGATGGCACATGGTTGTTTGTTTTTGCTGGCGTTGGAAAGACCTTCTGTACGAAGACGTTTCGA
CTGCGATTGTTGGTTCTGCCACGGGGCGTATCGGTGTGGATAATCTGTGTTGTCTCCCTTACTTCTTTGGTGTATCTACAGCATCAGTAATATGACTATCGGCTTCATCACCTCCTGACG
TCGCTTTGTCTAGCAAACACGGTCCCGCTGAGCCAATATCACTACCTATGCCATGCGCGATAGGCAAGCTTGGCACAACACGAAGCCGATCGCAGTATGCATATATCCCCAACTTCGCTC
CTCCTCACGGTGCCCGTCGCTGTCCCTGTCGCGCCCGTCAATCGCTGTGGATAGGTTCTGAGCCTGCTCTCGCCGGTGCAAGACGACTACCCAGACGTGTCCTACGCCGATCTGATCGTG
CTCGCGGGAAACCTCGCTCTCGAAATCGACCTGTCGTTCTGCGCGGGCCGCGTGGACGTCACCGAGGGCGACGACCTCATCTCGGTCCTCGAGCCCCGCGAGTACGACGACGTGATCGTG
GGCGTGCGCGACCGCATGAGGATCAGGGGCCTGTCGGTTGCACAGATGGTGGCCCTCGCCGGCCGCCCCCGCAGCGCCTCGCACATGATCACCCTCGGCTTCAGCGGGTCCTACACGAGC
GACGATCCCCCGGCCCTCTCCAACGCCTTCTACGTGACCCTCCTCACCGAGACCTGGGAGGAGGTACCCGGGTCCGACGGACAGGAGTACCAGGCCGTCGGCACGTCCGGCGTCTACGTG
CTGGCGACCGACCTGGCCCTTGTCTGGGACCCGGAGTTCAAGGCCCAGACGGTCATGTACGCCGAGGACAACGACCAGTTCCTCAAGGAGTTCGCTTCGGCCTGGACCGCGGTGATGAAC
GCCGACCGTTACGACGGGCCCACCGGCAACGTCTGTGACGACGTCTCGGGCGACTCCGACGACGACAGCAGCAGCGACGACCACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTCACAAGTGTAGGCTCGGGGTCCTGGCCACGTTGGCGTTCATCGCTTCGCCTGCATCCGCCGGCTGCCCGTTCCTCTCTGGCGAAAAGGGCTCGCAAGCCGACCTGAACCCCGGC
GTGGACCGTGCTCTGGGGTCCTACGACGATGATAGCAGCTACTATGGAGGTGCGGACTTCTCCCGCGAGACCTACGAAGCTCTTCAAGAGGACATCACGGCCATGTTCACCAACTCCATG
GACTTCTGGCCGGCCGACTTCGGCAACTATGCTCCCCTGATGATCCGCCTCGCCTGGCACTGCAACGGCAACTACCGCCAGTCGGACGGCCGCGGCGGCTGCGACGGTGGCCGGATCCGC
TTCAACCCGGAACGCAGCTGGGCGGACAACACCAACCTAGACAAGGCGCTGACACTCCTGCAGCCCATCAAGCTCAAGTACGGCGACGCCGTCTCGTGGGGAGACCTCATCACCCTGACG
GGTAACGAGGCGATCCGGACGATGGGCGGACCCGTGTTGGGGTTCTGCGCCGGAAGGCTTGACGATGCGAATGGCGTCGACAGCCTCGCGCTGGGCCCCTCTGACGAGCAGGAGGCCGTC
GCTCCTTGCGCCGTCAACGGGACTTGCGAAGCCCCTCTCGGCACCAGCACGGTGGGCTTGATCTACG
TGAACCCCGAGGGGCCCTCCGGCGTTCCCGACCCCGCGGGCAGCGCTGAAAGC
ATCCGGGATGTCTTCGGGCGGATGGGCATGAACGACAGCGAGACAGTGGCTCTCATCGGAGGAGGGCACGCCTTCG
GAAAGTTCCACGGCGCGTGTGACACCGGGCCCGGCGCCGACCCG
ATCGACGCCCCCGAAGCCCCCTGGCCGGGAACATGCGGCGACGTCGACTCCGCGACCTTCGGCCGCGCCGAGAACACCTTCACGAGCGGGTTCGAGGGCCAGTGGACGGTGGAGCCCCTG
GTGTGGGACAACCAGTACTTCAAGGACCTCCTCGAGTACGACTGGGTGATGACGGAAAGCCCCGCCGACCTCGTGCAGTGGTTCCCGGTCCTGAAGGAGGGGGCCACCGAGACGGAGGAC
GAGATCCCCGACATCATTATGCTCACCAGCGACGTCGCCTTGTTGTTT
GACCCGGAATACCTCGCCCTTTGCGAACTCTTCGCCAGCGACCAGGCCTACCTTGACACCGCCTTCGCCGCG
GCTTGGTACAAGCTCACCTCTCGCGACATGGGCCAGTTCCAGCGCTGCGTGGGCACCGACGTGGCGCCGCCTCAGGACTTCCAGCTGCCGCTCCCGGAGGCGCCCACCGACCTCCCCGAC
ACCGACGGGGCCAAGTCGGCGATCCAGAGCATCCTGTCCAGCGACCCGTCCTACCCCGCCCTATTCGTCACCCTGGCCTGGCAGTGCGCGTCCACCCACCGCTCGACCGACTTCTTGGGC
GGCTGCAATGGGGCGAGGATCCGATTCTCTCCCGAGAAGGACTGGGCCGGAAACCAGGGTCTCGACCAG
GTTCTGAGCCTGCTCTCGCCGGTGCAAGACGACTACCCAGACGTGTCCTAC
GCCGATCTGATCGTGCTCGCGGGAAACCTCGCTCTCGAAATCGACCTGTCGTTCTGCGCGGGCCGCGTGGACGTCACCGAGGGCGACGACCTCATCTCGGTCCTCGAGCCCCGCGAGTAC
GACGACGTGATCGTGGGCGTGCGCGACCGCATGAGGATCAGGGGCCTGTCGGTTGCACAGATGGTGGCCCTCGCCGGCCGCCCCCGCAGCGCCTCGCACATGATCACCCTCGGCTTCAGC
GGGTCCTACACGAGCGACGATCCCCCGGCCCTCTCCAACGCCTTCTACGTGACCCTCCTCACCGAGACCTGGGAGGAGGTACCCGGGTCCGACGGACAGGAGTACCAGGCCGTCGGCACG
TCCGGCGTCTACGTGCTGGCGACCGACCTGGCCCTTGTCTGGGACCCGGAGTTCAAGGCCCAGACGGTCATGTACGCCGAGGACAACGACCAGTTCCTCAAGGAGTTCGCTTCGGCCTGG
ACCGCGGTGATGAACGCCGACCGTTACGACGGGCCCACCGGCAACGTCTGTGACGACGTCTCGGGCGACTCCGACGACGACAGCAGCAGCGACGACCACTAA

Retrieve as FASTA