Entry information : TtraCP01
Entry ID 8392
Creation 2011-05-17 (Christophe Dunand)
Last sequence changes 2011-05-17 (Christophe Dunand)
Sequence status complete
Reviewer Marcel Zamocky
Last annotation changes 2011-12-22 (Christophe Dunand)
Peroxidase information: TtraCP01
Name TtraCP01
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Other; Other; Other; Other
Organism Thecamonas trahens    [TaxId: 529818 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TtraCP01
start..stop
S start..stop
SpliCP01 940 0 3..738 8..748
TcurCP01 929 0 4..741 17..747
FspCP_CcI3 929 0 8..738 18..743
RbaCP01_SH1 916 0 19..738 115..844
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 11903..11944 42 N° 2 12261..14447 2187  
join(11903..11944,12261..14447)


exon

Literature and cross-references TtraCP01
DNA ref. GenBank:   ADVD01001153.1 (11903..14447)
Protein sequence: TtraCP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   742
PWM (Da):   %s   79645.4  
PI (pH):   %s   4.74
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSASSSTGRCPNKSKGGTCPFKGHTNLAVGAPGIREWWPNSLNLKPLVTNSGLADPMGEDFDYAAEFAKVNLDELRNDVMKVMTTSQDWWPADYGHYGPFFIRMSWHAAGTYRVSDGRGGAGTGMQRFAPLNSWPDNANLDKARRLLWPIKKKYGRKISWADLIVYAGNLAIESMGLETVGFGFGRIDKYEPEDIFWGAETEWLTDSERYPKDGKRELAEGLGAVEHGLIYVNPEGPGGEPDPMKAAADIRESFGRMAMNDEETVALIAGGHTFGKAHGAADPSKYVGPEPEGESITARGLGWNSSYKSGAGAHAITSGLEGAWTPTPIQWDNSYFDMLFGYEWELTKSPAGASQWTPKGGSGSGLVPDAHDEAKSHPPIMFTTDLALRIDPDYERISRHFHSNPEAFGNAFARAWFKLLHRDMGPIARYLGPLVPTTPELWQDPLPSPPAAVIDADDIATLKAAISASDLTPAQLVRTAWASASTYRDTDKRGGANGARIRLSPQKDWPVNDPPALAAVLAVYDGIQANFNAGAKSVSMADLIVLGGVVGVEAAAAAAGHDICVAFTPGRTDASQDQTDTEGFAVLEPTADAFRNYYAPDNKRPAEQLLVDKTILLGITSPEMAVLLAGLRVIGANAAGSDLGVLTDRPGALTTDFFVNILDDSIDWAPAADGVYVGTERGSGATKWSATRADLIFSSNSQLRALAEVFAADDAADHFVNSFAAAWAKVMDLDRFDLRSRM*

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron). No EST. DNA contig matches with bacteria only for the CP sequence.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTGCATCATCGTCCACCGGTCGCTGCCCGAACAAATCGGTATGTACCCTCCCACACTTGAGAACACCAGCTCATATCTCCCCCACCCCCCTCCTTGTCCCCACTCTGACTGCGGCA
CTGGCTGCGGCACTGACTGCGACATCCGCAGCATATGTTCTTCCTTGCCAAACCGCCGCCCCTGCCTTTTTCCCGCAACCTTTATCTTAACTCACGTTCTTTTTCGCCGAAAATCCCATG
GCCTTTTTCGTTGGCGAATGTCTCGTGCACGTCGGATCGCTACACGCGTGCGGACGGTGGGCTCGTACACCTGCGGACACTCCCGCCGTTGTCTTCCTTCCCTCGGTCGGAACTGTAGAA
GGGCGGTACCTGCCCGTTCAAGGGTCATACCAACCTTGCTGTTGGTGCACCTGGCATCCGCGAATGGTGGCCCAACTCGCTCAACCTCAAGCCGCTGGTGACCAACAGCGGGCTGGCCGA
CCCCATGGGCGAGGATTTTGACTACGCGGCCGAGTTTGCCAAGGTCAATCTCGATGAGCTCCGCAACGATGTCATGAAGGTCATGACGACGTCGCAGGACTGGTGGCCGGCTGACTACGG
CCACTACGGCCCGTTCTTCATCCGCATGTCCTGGCACGCCGCAGGCACCTACCGCGTCTCGGACGGGCGTGGCGGCGCTGGGACCGGCATGCAGCGCTTTGCGCCGCTCAACTCGTGGCC
CGACAACGCAAACCTCGACAAGGCCCGCCGGCTGCTGTGGCCCATCAAGAAGAAGTACGGCCGCAAGATCTCGTGGGCCGACCTCATCGTGTACGCCGGCAACTTGGCCATCGAGTCGAT
GGGTCTCGAGACCGTCGGCTTTGGCTTTGGCCGCATCGACAAGTACGAGCCTGAGGACATCTTCTGGGGCGCCGAAACCGAGTGGCTCACTGACTCTGAGCGGTACCCCAAGGACGGCAA
GCGCGAGCTTGCTGAAGGCCTTGGTGCTGTCGAGCATGGCCTCATCTACGTCAACCCGGAGGGCCCCGGCGGCGAGCCGGACCCGATGAAGGCCGCCGCCGACATCCGCGAGTCGTTTGG
CCGCATGGCCATGAACGACGAAGAGACCGTCGCCCTCATTGCCGGAGGGCACACATTCGGCAAGGCCCACGGCGCTGCCGACCCGTCCAAGTACGTCGGGCCCGAGCCTGAGGGCGAGTC
CATCACCGCCCGCGGCCTCGGCTGGAACTCGTCGTACAAGTCGGGCGCCGGCGCACACGCCATCACCTCGGGCCTCGAGGGTGCATGGACTCCGACGCCCATCCAGTGGGACAACTCGTA
CTTTGACATGCTCTTTGGCTACGAGTGGGAGCTGACTAAGAGCCCGGCGGGCGCCTCGCAGTGGACGCCCAAGGGCGGCTCCGGCTCAGGCCTGGTTCCGGACGCGCACGATGAGGCCAA
GTCGCATCCGCCCATCATGTTCACCACTGATCTCGCCCTCCGCATCGACCCGGACTACGAGCGCATCTCGCGCCATTTCCACTCCAACCCGGAGGCCTTTGGCAACGCCTTTGCCCGGGC
CTGGTTCAAGCTCCTCCACCGCGATATGGGCCCCATCGCCCGCTACCTCGGCCCGCTTGTGCCCACCACTCCCGAGCTGTGGCAGGATCCGCTGCCGTCGCCGCCGGCTGCCGTCATCGA
CGCCGATGACATTGCCACGCTCAAGGCTGCCATCTCCGCCTCGGACCTCACCCCGGCCCAGCTCGTCCGCACCGCATGGGCCTCCGCCTCGACCTACCGCGACACCGACAAGCGCGGCGG
CGCCAACGGCGCCCGCATCCGCCTCTCGCCACAGAAGGACTGGCCCGTCAACGACCCGCCCGCCCTTGCGGCCGTCCTCGCCGTCTACGACGGCATTCAGGCCAACTTTAACGCCGGCGC
CAAGTCAGTCTCCATGGCCGACCTCATCGTCCTTGGAGGCGTCGTCGGCGTCGAGGCTGCTGCCGCCGCCGCCGGCCACGACATCTGCGTCGCCTTTACTCCCGGCCGCACCGACGCCAG
CCAGGACCAGACTGATACAGAGGGCTTTGCTGTCCTCGAGCCCACTGCAGACGCATTCCGCAACTACTACGCGCCCGACAACAAGCGCCCGGCCGAGCAGCTGCTCGTCGACAAGACCAT
CCTCCTTGGCATCACTAGCCCCGAGATGGCGGTCCTCCTTGCGGGCCTCCGCGTCATCGGTGCCAACGCTGCTGGCTCGGACCTCGGCGTCCTCACTGACCGGCCGGGTGCCCTCACCAC
AGACTTCTTCGTCAACATCCTGGACGACTCGATCGACTGGGCTCCGGCCGCCGATGGCGTGTACGTCGGCACCGAGCGTGGCTCCGGCGCTACCAAGTGGTCCGCCACCCGCGCCGACCT
CATCTTCTCCTCCAACTCGCAGCTCCGCGCCCTCGCTGAGGTCTTTGCCGCCGACGATGCCGCTGACCACTTTGTCAACTCCTTTGCCGCCGCATGGGCCAAGGTCATGGATCTCGACCG
CTTTGACCTCCGCTCGCGCATGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTGCATCATCGTCCACCGGTCGCTGCCCGAACAAATCGAAGGGCGGTACCTGCCCGTTCAAGGGTCATACCAACCTTGCTGTTGGTGCACCTGGCATCCGCGAATGGTGGCCCAAC
TCGCTCAACCTCAAGCCGCTGGTGACCAACAGCGGGCTGGCCGACCCCATGGGCGAGGATTTTGACTACGCGGCCGAGTTTGCCAAGGTCAATCTCGATGAGCTCCGCAACGATGTCATG
AAGGTCATGACGACGTCGCAGGACTGGTGGCCGGCTGACTACGGCCACTACGGCCCGTTCTTCATCCGCATGTCCTGGCACGCCGCAGGCACCTACCGCGTCTCGGACGGGCGTGGCGGC
GCTGGGACCGGCATGCAGCGCTTTGCGCCGCTCAACTCGTGGCCCGACAACGCAAACCTCGACAAGGCCCGCCGGCTGCTGTGGCCCATCAAGAAGAAGTACGGCCGCAAGATCTCGTGG
GCCGACCTCATCGTGTACGCCGGCAACTTGGCCATCGAGTCGATGGGTCTCGAGACCGTCGGCTTTGGCTTTGGCCGCATCGACAAGTACGAGCCTGAGGACATCTTCTGGGGCGCCGAA
ACCGAGTGGCTCACTGACTCTGAGCGGTACCCCAAGGACGGCAAGCGCGAGCTTGCTGAAGGCCTTGGTGCTGTCGAGCATGGCCTCATCTACGTCAACCCGGAGGGCCCCGGCGGCGAG
CCGGACCCGATGAAGGCCGCCGCCGACATCCGCGAGTCGTTTGGCCGCATGGCCATGAACGACGAAGAGACCGTCGCCCTCATTGCCGGAGGGCACACATTCGGCAAGGCCCACGGCGCT
GCCGACCCGTCCAAGTACGTCGGGCCCGAGCCTGAGGGCGAGTCCATCACCGCCCGCGGCCTCGGCTGGAACTCGTCGTACAAGTCGGGCGCCGGCGCACACGCCATCACCTCGGGCCTC
GAGGGTGCATGGACTCCGACGCCCATCCAGTGGGACAACTCGTACTTTGACATGCTCTTTGGCTACGAGTGGGAGCTGACTAAGAGCCCGGCGGGCGCCTCGCAGTGGACGCCCAAGGGC
GGCTCCGGCTCAGGCCTGGTTCCGGACGCGCACGATGAGGCCAAGTCGCATCCGCCCATCATGTTCACCACTGATCTCGCCCTCCGCATCGACCCGGACTACGAGCGCATCTCGCGCCAT
TTCCACTCCAACCCGGAGGCCTTTGGCAACGCCTTTGCCCGGGCCTGGTTCAAGCTCCTCCACCGCGATATGGGCCCCATCGCCCGCTACCTCGGCCCGCTTGTGCCCACCACTCCCGAG
CTGTGGCAGGATCCGCTGCCGTCGCCGCCGGCTGCCGTCATCGACGCCGATGACATTGCCACGCTCAAGGCTGCCATCTCCGCCTCGGACCTCACCCCGGCCCAGCTCGTCCGCACCGCA
TGGGCCTCCGCCTCGACCTACCGCGACACCGACAAGCGCGGCGGCGCCAACGGCGCCCGCATCCGCCTCTCGCCACAGAAGGACTGGCCCGTCAACGACCCGCCCGCCCTTGCGGCCGTC
CTCGCCGTCTACGACGGCATTCAGGCCAACTTTAACGCCGGCGCCAAGTCAGTCTCCATGGCCGACCTCATCGTCCTTGGAGGCGTCGTCGGCGTCGAGGCTGCTGCCGCCGCCGCCGGC
CACGACATCTGCGTCGCCTTTACTCCCGGCCGCACCGACGCCAGCCAGGACCAGACTGATACAGAGGGCTTTGCTGTCCTCGAGCCCACTGCAGACGCATTCCGCAACTACTACGCGCCC
GACAACAAGCGCCCGGCCGAGCAGCTGCTCGTCGACAAGACCATCCTCCTTGGCATCACTAGCCCCGAGATGGCGGTCCTCCTTGCGGGCCTCCGCGTCATCGGTGCCAACGCTGCTGGC
TCGGACCTCGGCGTCCTCACTGACCGGCCGGGTGCCCTCACCACAGACTTCTTCGTCAACATCCTGGACGACTCGATCGACTGGGCTCCGGCCGCCGATGGCGTGTACGTCGGCACCGAG
CGTGGCTCCGGCGCTACCAAGTGGTCCGCCACCCGCGCCGACCTCATCTTCTCCTCCAACTCGCAGCTCCGCGCCCTCGCTGAGGTCTTTGCCGCCGACGATGCCGCTGACCACTTTGTC
AACTCCTTTGCCGCCGCATGGGCCAAGGTCATGGATCTCGACCGCTTTGACCTCCGCTCGCGCATGTAA

Retrieve as FASTA