Entry information : DpuKat02
Entry ID 8406
Creation 2011-05-29 (Marcel Zamocky)
Last sequence changes 2011-05-29 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-05-30 (Christophe Dunand)
Peroxidase information: DpuKat02
Name DpuKat02
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Dictyostelium
Organism Dictyostelium purpureum    [TaxId: 5786 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value DpuKat02
start..stop
S start..stop
DdKat02 1055 0 1..691 1..692
PfKat03_Pf5 884 0 2..691 25..712
PaerKat03_PAO1 867 0 2..691 24..709
MflaKat01 833 0 4..691 26..712
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 11032..11047 16 N° 2 11179..11345 167 N° 3 11452..11753 302 N° 4 11843..11847 5
N° 5 11915..13500 1586  
join(11032..11047,11179..11345,11452..11753,11843..11847,11915..13500)


exon

Literature and cross-references DpuKat02
Literature Sucgang R., Kuo A., Tian X., Salerno W., Parikh A., Feasley C.L., Dalin E., Tu H., Huang E., Barry K., Lindquist E., Shapiro H., Bruce D., Schmutz J., Salamov A., Fey P., Gaudet P., Anjard C. , Mohan M.B., Basu S., Bushmanova Y., van der Wel H., Katoh-Kurasawa M., Coutinho P.M., Saito T., Elias M., Schaap P., Kay R.R., Henrissat B., Eichinger L., Rivero F., Putnam N.H., West C.M., Loomis W.F., Chisholm R.L., Shaulsky G., Strassmann J.E., Queller D.C., Kuspa A., Grigoriev I.V. Comparative genomics of the social amoebae Dictyostelium discoideum and Dictyostelium purpureum (unpublished since 2010)
Protein ref. GenBank:   EGC36159.1 UniProtKB:   F0ZIQ0
DNA ref. GenBank:   GL871035.1 (11032..13500)
EST ref. GenBank:   GR568964.1 [5' end]   GR580651.1 [3' end]
Protein sequence: DpuKat02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   691
PWM (Da):   %s   77805.4  
PI (pH):   %s   6.74
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDKKIEQLKCFESSPKGENSTTNFGVKISNDENTLKAGPRGPSLLEDFVFREKMTHFDHEIPERIVHARGSGAHGYFVSYADHSNLTKASFLSAKDKKTPLFARVSTVQGPRGSADTVRDVRGFAVKFYTDEGNFDIVGNNIPVFFVQDAISFPDFVHAGKEQQNEMPTGGSAHDTFYDYISLKPETAHTVMWVMSDRGIPLSIRHLQAFGVHTYRLINAQGKSTFIKWFWKPLSGTLSLLWDEAQKIAGKNGDYHRKRLWDDIEAGDFPQWELCVQILSDEIIEKFEFDILDPTKFIPEELAPVTPVGRMVLNKNPDNFFAETEQIAFCVSHVVPGIDFSNDPLLQGRIFSYLDTQLSRLGGPNFNEIPINRPVCPFANTQRDGIHRMTINKGGANYFPNSIDGNYPRPKEEASVKGGFLPYPEKIDAVKTYKRSETFNDHFSQATMFWNSMSQHEKNHIVDGFSFELSKVTRRNIVERVVNEFLINIDKTLAEKVGKNLGVTVEPKVTKNIQKKLVKPSPAISQVNLLSGDIASRRIAVLIFDGCDTEDVMSFKKEMEKRDAHVDLLAPSNAPVRGCDGPSLTPKSSWVSEPSIFYDAVYVPSCGQESLELLQHNGDFLHYILESYKHLKTIAFSGCPSIIKETLRLKQDLGLILGQGWRDVVEAFTYSLAHHRVWERESLASTIPA

Retrieve as FASTA  
Remarks complete sequence from genomic (4 introns) and 24 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATAAGAAAATAGGTAAGTTATTATAAAAAAGAAATAATTTGTATTTAATAACAATAATATGTAAATAATAAAAACCATAATTAAAACAAAATATTTTATAATTTTATTTTACCAAA
TAGCTATTAACATATAATATCTTTTAGAACAATTAAAATGTTTTGAAAGTAGCCCAAAAGGTGAAAACTCAACTACAAATTTTGGAGTTAAAATCTCAAATGATGAAAACACCTTAAAAG
CAGGTCCAAGGGGTCCTTCATTATTAGAGGATTTTGTTTTTAGGGAAAAAATGACCCATTTCGATCATGAAAGA
GTATGAAATATTATTATTATTGAGTTTTTATTTATATTTTTATTTA
TATTTTTATTTATATTTTTATTTATATTTTTATTTTTATTTACAATTTTATTATTTTTAGATCCCAGAAAGAATAGTTCACGCAAGAGGAAGTGGTGCACATGGTTATTTTGTTTCATAT
GCAGATCATAGTAATCTTACAAAAGCAAGTTTCCTTTCAGCAAAAGATAAGAAAACACCTCTTTTCGCTCGTGTTTCAACTGTTCAAGGTCCTAGAGGTTCAGCTGATACCGTACGTGAT
GTTAGAGGTTTTGCTGTTAAATTCTATACTGACGAAGGTAATTTTGATATTGTTGGAAACAATATTCCAGTTTTCTTTGTTCAAGATGCAATTAGTTTCCCAGACTTTGTACATGCTGGT
AA
GTACTAAAATAAAATAAATAATAATAATAACAATTATCATAATAATACTAATACTAAATTATTTTTAATAATTTTTTATTTTTAGTTAAAATGGGTAAGGATTTAAAATAAAATTTAT
TTATTTTAAAAATATATTTATTAATTATTTTAATATTATTTAGAACAACAAAACGAAATGCCAACTGGTGGATCAGCCCATGATACATTTTATGACTATATAAGTTTAAAACCAGAAACT
GCTCATACAGTAATGTGGGTAATGTCTGATAGGGGTATTCCATTGTCAATTCGTCATTTACAAGCATTTGGTGTTCATACTTATAGACTAATTAATGCTCAAGGAAAATCAACATTTATC
AAATGGTTTTGGAAACCATTAAGTGGTACTCTTTCATTACTTTGGGACGAAGCACAAAAGATAGCTGGAAAAAACGGTGACTATCACAGAAAGAGACTTTGGGATGATATCGAAGCTGGC
GATTTTCCACAATGGGAGCTCTGTGTTCAAATTTTATCTGATGAAATTATTGAAAAGTTTGAATTTGACATTTTAGACCCAACAAAATTTATTCCAGAAGAACTTGCACCAGTTACACCA
GTAGGTAGAATGGTATTAAATAAGAATCCAGATAATTTCTTTGCTGAAACTGAACAAATTGCTTTTTGTGTTTCTCATGTAGTACCAGGTATAGATTTCAGTAATGATCCATTACTCCAA
GGTCGTATTTTCTCATACTTAGATACCCAGCTAAGTCGTTTAGGAGGTCCAAACTTTAATGAAATCCCTATCAATAGACCAGTTTGCCCATTTGCAAATACCCAAAGAGATGGTATTCAT
AGAATGACTATTAATAAAGGTGGTGCTAACTATTTCCCAAATTCAATTGATGGCAATTACCCAAGACCAAAAGAAGAAGCTAGTGTAAAAGGTGGCTTCCTTCCATATCCTGAAAAAATT
GATGCTGTTAAAACCTACAAGAGAAGCGAAACTTTTAATGACCATTTCTCACAAGCAACCATGTTCTGGAATTCAATGAGTCAACACGAAAAGAACCATATTGTTGATGGTTTCTCTTTT
GAACTATCAAAAGTAACCAGAAGAAACATTGTAGAACGTGTTGTCAACGAATTTCTCATCAATATTGATAAGACCCTTGCAGAGAAAGTTGGTAAAAACTTGGGTGTTACAGTAGAACCA
AAAGTAACAAAAAATATTCAAAAGAAATTAGTAAAACCATCACCAGCAATCAGTCAAGTAAATCTATTATCTGGGGATATAGCATCACGTAGAATTGCTGTACTCATCTTTGATGGATGT
GACACAGAAGATGTTATGTCATTTAAAAAAGAAATGGAAAAAAGAGATGCTCATGTAGATTTACTAGCCCCATCAAATGCACCAGTCAGAGGATGTGACGGTCCATCTTTAACCCCAAAG
AGTAGTTGGGTAAGTGAACCAAGTATTTTCTATGATGCCGTTTATGTTCCATCTTGTGGTCAAGAATCATTAGAACTCCTTCAACACAATGGTGATTTCCTTCACTACATTTTAGAATCT
TACAAACATCTTAAAACAATTGCATTTAGTGGTTGTCCATCAATTATCAAAGAAACTCTTCGTTTAAAACAAGATCTTGGTTTGATTTTAGGTCAAGGTTGGAGAGATGTTGTTGAAGCT
TTCACCTATTCATTAGCACACCATAGAGTTTGGGAAAGAGAATCATTGGCCAGTACCATTCCAGCTTAG

Retrieve as FASTA